Identification of a naturally occurring recombinant Epstein-Barr virus isolate from New Guinea that encodes both type 1 and type 2 nuclear antigen sequences

J M Burrows, R Khanna, T B Sculley, M P Alpers, D J Moss, S R Burrows
1996 Journal of Virology  
In this report we describe an Epstein-Barr virus isolate, derived from the peripheral blood lymphocytes of a healthy adult from Papua New Guinea, that is a recombinant of the two major Epstein-Barr virus types, encoding type 1 Epstein-Barr nuclear antigen 2 (EBNA2) sequences, and type 2 EBNA3, EBNA4, and EBNA6 sequences. Epstein-Barr virus (EBV), a lymphotropic herpesvirus that also infects and replicates in oropharyngeal epithelial cells, has a long-established association with Homo sapiens.
more » ... ith Homo sapiens. It is the causative agent of acute infectious mononucleosis and an acute lymphoproliferative disease in immunosuppressed patients and is associated with Burkitt's lymphoma and nasopharyngeal carcinoma (16). The multitude of different EBV strains can be classified into two broad types designated EBV-1 and EBV-2, paralleling the nomenclature of herpes simplex virus types 1 and 2. The two EBV types (which are also referred to as A type and B type) are distinguished by divergent DNA sequences in genes that encode several of the EBV nuclear antigens (EBNAs). EBNA3, EBNA4, EBNA6 (also referred to as EBNA3A, EBNA3B, and EBNA3C, respectively), and EBNA2 of the prototype EBV-1 strain (derived from the B95-8 cell line) differ in their amino acid sequences from corresponding proteins of the prototype EBV-2 strain (derived from the Ag876 cell line) by 16, 20, 28, and 47%, respectively (1, 10, 20). These differences are reflected in the common detection of antibody (23, 32, 33) and cytotoxic T lymphocyte (7, 8, 17) responses that are EBV type specific. While most individuals in Western societies carry EBV-1, a substantial proportion of the normal populations of Africa and New Guinea is infected with EBV-2 (32, 33). Coinfection with EBV-1 and EBV-2 has been demonstrated in Caucasian individuals (13, 23, 30) and is particularly common in immunosuppressed patients, in which individuals the susceptibility to superinfection is presumably higher (5, 13, 21, 26) . This report describes the unusual EBV isolate MK, which was derived from a lymphoblastoid cell line (LCL) raised from a healthy adult male born in Chimbu Province in the highlands of Papua New Guinea. The LCL was established by spontaneous outgrowth from peripheral lymphocytes cultured in the presence of 0.1 g of cyclosporin A per ml (18). DNA samples from the MK LCL were always derived from early passages of the cell line. To determine the EBV type of this isolate, PCR was used to amplify a region of the EBNA2 gene with primers specific for either EBV-1 (2A.1 and 2A.2, based on the B95-8 sequence) or EBV-2 (2B.1 and 2B.2, based on the Ag876 sequence) (2). The PCR was carried out as previously described (2), and amplified products were electrophoresed on a 2% agarose gel (SeaKem; FMC Bioproducts). The products obtained with the 2A.1 and 2A.2 or 2B.1 and 2B.2 primers were confirmed to be of type 1 or type 2 origin, respectively, by testing duplicate samples by a rapid PCR enzyme-linked immunosorbent assay (ELISA) method (Boehringer, Mannheim, Germany) and with the capture probes 49,245 5ЈCATCTCCCTG TCTTGCATGTGCCAGACCAA3Ј 49,274 (B95-8 coordinates, type 1 specific) and 2,107 5ЈCTAATCAACCAGCCACAACAC CACCCACGG3Ј 2,136 (Ag876 coordinates, type 2 specific) (data not shown). Briefly, this involved labelling the PCR products with digoxigenin during the amplification process, after which a solution hybridization colorimetric analysis was performed with the specific biotin-labelled capture probes, an anti-digoxigenin peroxidase conjugate, and the substrate 2,2Ј-azino-di-3ethylbenzthiazoline sulfonate (ABTS). As shown in Fig. 1A and B, the New Guinea isolate MK (lanes 4) was defined as type 1 with these EBNA2 primers. Other samples included the control type 1 B95-8 strain ( Fig. 1A and B, lanes 2) and the type 2 Ag876 strain (lanes 3), as well as four other isolates derived from LCLs raised spontaneously from healthy New Guinea donors which were also defined as type 1 (lanes 5 to 8). In a recent study designed to analyze sequence variation within wild-type EBV-1 isolates from New Guinea at regions of the nuclear antigens corresponding to defined cytotoxic T lymphocyte epitopes (6), the EBV isolate MK could not be sequenced within an area of EBNA3 because of the inability to amplify extracted DNA with primers specific for type 1 EBV. To further investigate the EBNA3 gene of this isolate, viral DNA was typed by the above procedure but with primers from another EBNA3 region that were also specific for type 1 EBV. These primer sequences, with B95-8 coordinates, were 93,682 5ЈTAGCAGCTCAGGGAATGGCA3Ј 93,701 (E3A.F) and 93,993 5ЈGAACTGGCTTGGGGTAAACT3Ј 93,974 (E3A.R). The rapid PCR ELISA method, with the EBNA3 type 1-specific probe 93,758 5ЈTACGCCCTTGCCCCCTGTATCTCCAG3Ј 93,783 , was used to confirm that the products obtained were of type 1 origin (data not shown). Surprisingly, DNA from the MK EBV isolate (Fig. 1C, lane 4) was not amplified with these primers,
doi:10.1128/jvi.70.7.4829-4833.1996 fatcat:p3knn52knbcrrk45mvegf42l34