Structural Basis for Stable DNA Complex Formation by the Caspase-activated DNase

Stefanie Reh, Christian Korn, Oleg Gimadutdinow, Gregor Meiss
2005 Journal of Biological Chemistry  
We describe a structural model for DNA binding by the caspaseactivated DNase (CAD). Results of a mutational analysis and computational modeling suggest that DNA is bound via a positively charged surface with two functionally distinct regions, one being the active site facing the DNA minor groove and the other comprising distal residues close to or directly from helix ␣4, which binds DNA in the major groove. This bipartite protein-DNA interaction is present once in the CAD/inhibitor of CAD
more » ... ibitor of CAD heterodimer and repeated twice in the active CAD dimer. The caspase-activated DNase (CAD) 2 (DFF40) is the nuclease subunit of the DNA fragmentation factor DFF, a heterodimeric complex that triggers DNA degradation in apoptotic cells (1-5). Within the complex, CAD is kept inactive by the inhibitory subunit ICAD-L (DFF45) (6 -8). Activation of DFF is achieved by removing ICAD-L via cleavage by caspase-3, allowing two subunits of CAD to form a scissor-like homodimer with the catalytic center near the base of a deep active site crevice (1, 9, 10) . This prerequisite for DNA cleavage in an embedded active site may thus explain the preference of the enzyme for cutting accessible linker DNA between nucleosomes, a process referred to as apoptotic DNA laddering. As shown recently by biochemical and crystallographic studies, CAD belongs to the H-N-H or ␤␤␣-Me-finger superfamily of nucleases with a common active site motif (10 -13). This motif, consisting of two antiparallel ␤-strands and an ␣-helix, can be found in a large number of enzymes, ranging from nonspecific to highly sequence-or structurespecific nucleases with diverse structures and biological functions (14 -16). CAD cleaves naked DNA as a nonspecific nuclease, yet in contrast to other nonspecific nucleases both free CAD and, notably, the inhibited enzyme are proficient in forming stable DNA complexes (17, 18). Formation of stable DNA complexes by the DFF (CAD⅐ICAD) complex prior to its activation by caspase-3 leads to stimulation of CAD activity and thus might accelerate DNA fragmentation in apoptotic cells (17) . Typically, nonspecific nucleases, e.g. DNase I, exhibit only transient interactions with their substrates sufficient to bring about nucleic acid cleavage in the absence of highly specific complex formation (14, 19, 20) . This concept is also illustrated by the co-crystal structures of three bacterial enzymes related to CAD, the Vibrio vulnificus nuclease (Vvn) and the Escherichia coli nuclease colicins E7 (ColE7) and E9 (ColE9) (14, 21-23). Vvn nuclease and ColE7/E9 are a periplasmic nuclease and bacterial toxins engaged in host defense and cell killing, respectively. These nonspecific nucleases mainly bind DNA in the minor groove, with their ␤␤␣-Me-finger motifs forming contacts to the phosphodiester backbone of one strand of the substrate and establishing only minor contacts to the DNA major groove (21-23). In contrast, the sequence-specific members of the H-N-H or ␤␤␣-Me-finger nucleases, such as the homing endonucleases I-PpoI or I-HmuI, also use their ␤␤␣-Me-finger motifs to contact the cleavage site via the DNA minor groove. In addition, they use more structural elements to form specific contacts to the phosphodiester backbone and the bases via the minor and major grooves of their DNA substrates (24 -26). With the aim of identifying the structural basis for the unusual capacity of CAD to form stable DNA complexes as a nonspecific nuclease, we performed a mutational analysis of putative DNA binding residues in combination with computational modeling of CAD⅐DNA complexes on the basis of DNA co-crystal structures of the above mentioned related nonspecific nucleases (21-23). Our results suggest that CAD forms stable DNA complexes via a DNA binding region that comprises residues close to or directly from helix ␣4 distal to the active site. GAGT CGGCATTTCGAAATAAGTCGGGCTA), R166A (ACAGCTGT-GAGAGTGCAATCCGCGGTTACCTAAGAGA), R168A (TGAGAGTC-. 2 The abbreviations used are: CAD, caspase-activated DNase (synonym for DFF40); DFF40, DNA fragmentation factor 40-kDa subunit (synonym for CAD); DFF45, DNA fragmentation factor 45-kDa subunit (synonym for ICAD-L); EMSA, electrophoretic mobility shift assay; ICAD, inhibitor of CAD; ICAD-L, ICAD large isoform (synonym for DFF45); PAR, poly(ADP-ribose); CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid.
doi:10.1074/jbc.m509133200 pmid:16236713 fatcat:zuin5jkbkba63mreavdsa73ggi