Human immunodeficiency virus type 1 nucleocapsid protein reduces reverse transcriptase pausing at a secondary structure near the murine leukemia virus polypurine tract

W Wu, L E Henderson, T D Copeland, R J Gorelick, W J Bosche, A Rein, J G Levin
1996 Journal of Virology  
In an earlier study on minus-strand DNA synthesis catalyzed by murine leukemia virus reverse transcriptase, we described a prominent pause site near the polypurine tract (J. Guo, W. Wu, Z. Y. Yuan, K. Post, R. J. Crouch, and J. G. Levin, Biochemistry 34:5018-5029, 1995). We now report that pausing at this site is due to a stem-loop structure in the RNA template, formed by interaction of a number of bases in the polypurine tract, including the six G's, and a 3 sequence which includes four C's.
more » ... dition of human immunodeficiency virus type 1 (HIV-1) nucleocapsid (NC) protein to reverse transcriptase reactions reduces pausing by ϳ8to 10-fold and stimulates synthesis of full-length DNA. Thus, NC functions as an accessory protein during elongation of minus-strand DNA and increases the efficiency of DNA synthesis, in this case, by apparently destabilizing a region of secondary structure in the template. Since NC is associated with genomic RNA in the viral core and is likely to be part of a viral replication complex, these results suggest that NC may also promote efficient DNA synthesis during virus replication. Mutational analysis indicates that the features of HIV-1 NC which are important for reduction of pausing include the basic amino acids flanking the first zinc finger, the zinc fingers, and the cysteine and aromatic amino acids within the fingers. These findings suggest that reverse transcription might be targeted by drugs which inactivate the zinc fingers of HIV-1 NC. Materials. Restriction enzymes, T4 ligase, and Taq polymerase were purchased from Boehringer Mannheim. T4 polynucleotide kinase was obtained from Promega Biotech. A MEGAscript kit, purchased from Ambion, was used to make T7 transcripts. [␥-32 P]ATP (3,000 Ci/mmol) and [␣-35 S]dATP␣S were purchased from Amersham Life Science Inc. The deoxynucleoside triphosphates were obtained from Pharmacia LKB Biotechnology Inc. DNA oligonucleotides were synthesized on a Biosearch Synthesizer model 8750 (New Brunswick Scientific Co.) or were purchased from Lofstrand. DNA sequencing was performed with a Sequenase kit obtained from U.S. Biochemical Corp. Construction of plasmids. Clone pPPT-A (35), which contains the AKR MuLV PPT and surrounding 5Ј and 3Ј sequences (nt 7602 to 8033 [39]) in the pGEM3Z vector, was used to generate three new clones with mutations in the PPT and/or surrounding sequences. PCRs were carried out with pPPT-A as the template and a 17-nt universal sequencing primer, 5Ј-GTTTTCCCAGTCAC GAC (U.S. Biochemical Corp.), as the forward primer in all cases. The reverse primers were as follows. (i) The primer used to change the four C's downstream of the PPT (nt 7834 to 7837 [39]) to 5Ј-TGTA (clone pWW4C) was 5Ј-AAAA CTGCAGTTAGCTGGCTAAGCCTTATGAATACATCTTTCATTCCCCCC (complementary to nt 7819 to 7865 [39]). (ii) The primer used to change the 6 G's in the PPT (nt 7819 to 7824 [39]) to 5Ј-TCATAC (clone pWW6G) was 5Ј-AA AACTGCAGTTAGCTGGCTAAGCCTTATGAAGGGGTCTTTCATTGTA TGATCTTTCTGTAA (complementary to nt 7808 to 7865 [39]). (iii) The primer used to exchange the positions of the four C's and the six G's (clone pWWsw) was 5Ј-AAAACTGCAGTTAGCTGGCTAAGCCTTATGAACCCCCCTCTTT CATTGGGGTCTTTCTGTAA (complementary to nt 7808 to 7865 [39] ). The PCR products were digested with EcoRI and PstI, which removed the four A's at the 5Ј ends of the reverse primers and also provided the ends for subsequent ligation. To replace the wild-type sequence with mutant sequences, each of the PCR fragments was ligated together with EcoRI-SalI (ϳ3.2 kb) and 180-bp PstI-SalI fragments from pPPT-A. The entire viral insert, including the region containing the mutation, was sequenced in each of the clones. Preparation of recombinant or chemically synthesized NC proteins. Fusion protein vectors for bacterial expression of recombinant NC were constructed as follows. DNA fragments containing NC coding sequences for wild-type and zinc finger "switch" mutants (1:1, 2:2, and 2:1) were generated by PCR from proviral clones described previously (32, 34 [and references therein]). The PCR primer used to amplify the 5Ј end of the NC gene was 5Ј-GAGCTCGGTACCCGGCC GGGG; the primer used for amplification of the 3Ј end was 5Ј-GTACGTGTC GACTTAATTAGCCTGTCTCTCAGTACAATTTTTGGCTATGTGCCC. The PCR fragments were purified, digested with KpnI and SalI, and cloned into the corresponding sites in pMALc (Pharmacia Biotech, Piscataway, N.J.). DNA sequencing was used to verify the sequence of each construct. Bacterial clones containing the wild-type NC and zinc finger switch mutant sequences were grown in Luria-Bertani broth at 37ЊC to an A 600 of 0.5. Isopropyl ␤-D-thiogalactopyranoside was then added to a final concentration of 0.3 mM, and fusion proteins were induced for 3.5 h. The bacteria were pelleted and resuspended in buffer containing 10 mM Tris-0.25%
doi:10.1128/jvi.70.10.7132-7142.1996 fatcat:7n7vqd3r5nclfcjmc2akxy4wh4