Domain swapping oligomerization of thermostable c-type cytochrome in E. coli cells

Yugo Hayashi, Masaru Yamanaka, Satoshi Nagao, Hirofumi Komori, Yoshiki Higuchi, Shun Hirota
2016 Scientific Reports  
S2 Materials and Methods Construction of HT cyt c 552 expression system. Insertion of a His-tag (GSGHHHHHH) at the C-termini of WT I76V, A5F/M11V, Y32F/Y41E, and A5F/M11V/Y32F/Y41E/I76V HT cyt c552 was performed by PCR-based in vitro mutagenesis of the plasmid DNA coding HT cyt c552 with a KOD Plus mutagenesis kit (TOYOBO) using forward (GGCTCGGGCCATCATCATCATCATCATTAAGTCGACCTGCAGCCAAGCTT) and reverse primers (CTTTATGGAGAGTATCCACTGGGC for WT, A5F/M11V, and Y32F/Y41E HT cyt c552;
more » ... ACTGGGC for I76V and A5F/M11V/Y32F/Y41E/I76V HT cyt c552). The plasmid DNAs were enhanced with DH5α cells, and transformed into E. coli JCB387 containing the pEC86 plasmid DNA 1 . Purification of HT cyt c 552 . The cultured E. coli cells were suspended with 25 mM acetic acid buffer, pH 5.0, and centrifuged (13,700 g, 10 min, 4 °C). The cells were suspended again with 100 mM Tris-HCl buffer, pH 8.0, containing 10 mM EDTA and 20% (w/v) sucrose, and subsequently incubated on ice for 1 h and centrifuged (13,700 g, 10 min, 4 °C). The cells were finally suspended with 100 mM potassium phosphate buffer, pH 7.0, freeze-thawed, and centrifuged (13,700 g, 10 min, 4 °C). Streptomycin (1% w/v, Nacalai tesque) was added to the supernatant, and the solution was incubated on ice for 30 min and subsequently centrifuged (13,700 g, 10 min, 4 °C). The solution was dialyzed overnight at 4 °C with 10 mM potassium phosphate buffer, pH 7.0, containing 1 mM streptomycin. Oxidized HT cyt c552 was prepared by an addition of 50 mM potassium ferricyanide to the sample solution (final concentration, 50 μM), and purified with a CM Sepharose (Wako) column. The elution solution containing oligomeric HT cyt c552 was analyzed by size exclusion chromatography (column: Hiload 16/600 Superdex75 pg or Superdex 75 10/300 GL, GE Healthcare) using a FPLC system (BioLogic DuoFlow 10, Bio-Rad) as reported 2 . SDS-PAGE was performed with 18% gel for the fractions obtained by size exclusion chromatography. The gels were heme-stained with 3,3',5,5'-tetramethylbenzidine (TCI, Tokyo, Japan) and hydrogen peroxide for detection of heme c 3 . WT and A5F/M11V/Y32F/Y41E/I76V HT cyt c552 without a His-tag were purified with a CM Sepharose (Wako) column and size exclusion chromatography (column: Hiload 26/600 Superdex75 pg, GE Healthcare) using the FPLC system (BioLogic DuoFlow 10, Bio-Rad) as reported 2 . His-tagattached WT, I76V, A5F/M11V, Y32F/Y41E, and A5F/M11V/Y32F/Y41E/I76V HT cyt c552 were extracted from E. coli by freeze-thaw and sonication. The amount of extracted His-tag-attached HT cyt c552 was estimated by the pyridine hemochrome method 4 . The His-tag-attached HT cyt c552 were purified with a HisTrap HP column (GE Healthcare) using the FPLC system (BioLogic DuoFlow 10, Bio-Rad) (flow rate, 1.0 mL/min; monitoring wavelength, 280 nm and 410 nm; gradient, 25 mM Tris-HCl buffer, pH 8.0, containing 0.5 M NaCl and the same buffer containing 0.5 M NaCl and 0.5 M imidazole; temperature, 4 °C). E. coli JCB387 not containing pKO2 and pEC86 plasmid DNAs was cultured to investigate the effect of freeze-thaw on oligomerization.
doi:10.1038/srep19334 pmid:26838805 pmcid:PMC4738263 fatcat:u2fyjwojsbgx5intzwrugregey