The epidemiological analysis of Erysipelothrix isolates recovered from pigs, cattle and chickens was studied by the analysis of acriflavine resistance and the PCR-based DNA fingerprinting method using random amplified polymorphic DNA (RAPD). Thirty-two Erysipelothrix field isolates, 1 Erysipelothrix reference strains and +random primers were tested. Among the tested primers, the primers NK0 (CCCGCGCCCC) and D3-// (CCGGATCCGTGATGCGGTGCG) produced noticeable results. The primer NK0 revealed /

more »

... patterns (aῌe) while primer D3-// revealed 2 RAPD patterns (AῌH) that were not serovar specific. Namely, di#erent patterns were produced among strains of the same serovar showing that the RAPD method is able to identify the genetic variations of Erysipelothrix species but the RAPD data demonstrated that the some serovar +a E. rhusiopathiae strains including strain Koganei 0/ῌ*.+/ for the production of live vaccine were closely related each other genetically, irrespective of their acriflavine resistance. Based on these results, we concluded that the RAPD method with primer D3-// is a rapid and reliable method to di#erentiate Erysipelothrix isolates from various animals ; and might be a useful tool for the epidemiological analysis of the Erysipelothrix species.