Surveillance of Fluoroquinolone-Resistant Clinical Isolates of Pseudomonas aeruginosa

Hideki Kobayashi, Miho Isozaki, Tatsuya Fukuda, Yojiro Anzai, Fumio Kato
2013 Open Journal of Medical Microbiology  
Ciprofloxacin (CPFX) and pazufloxacin (PZFX) have strong antibacterial activity against Pseudomonas aeruginosa. We investigated the sensitivity of P. aeruginosa to CPFX and PZFX in 373 strains isolated from inpatients (321 strains) and outpatients (52 strains) during September 2010 to September 2011 at Toho University Ohashi Medical Center. The percentage of CPFX-non-susceptible (≥3.91 µg/mL) among inpatients was 22.4%, but that among outpatients was 1.9%. As the major resistance mechanism to
more » ... ance mechanism to fluoroquinolones in P. aeruginosa involves modification of type II topoisomerases (DNA gyrase and topoisomerase IV), we examined mutations in the quinolone-resistance-determining regions (QRDRs) of gyrA and parC of P. aeruginosa isolates. Among the 373 isolates, 73 isolates had reduced CPFX-susceptibility and 88 had reduced PZFX-susceptibility. Sequencing of gyrA and parC revealed base substitutions that resulted in amino acid replacements in QRDR of GyrA in 70 P. aeruginosa isolates, while Thr83Ile (in GyrA) and Ser87Leu (in ParC) substitutions were found in 12 strains. These replacements were clearly associated with reduced susceptibility to CPFX and PZFX. However, we also found strains with high MICs to quinolones without mutations in either gyrA or parC. We then investigated the effect of efflux pumps in CPFX-resistance in these isolates. In the presence of an efflux pump inhibitor, MIC values in 12 of 66 strains decreased to 1/2 3 . We also sequenced genes related to overexpression of efflux pumps, viz., mexZ, mexR, and nfxB. Eight of the strains without mutations in QRDRs had a mutation in mexZ, 7 strains had a mutation in mexR, but no mutation was identified in nfxB. Underline : 5'-end attached oligonucleotides for sequencing; GTTTTCCCAGTCACGACGTTG, M13M4 Forward oligonucleotide; TGTAAAACGACGGCCA GT, M13(-21) Forward oligonucleotide; CAGGAAACAGCTATGAC, M13 Reverse oligonucleotide.
doi:10.4236/ojmm.2013.32022 fatcat:tlktl2ebhzatxlk2pwwaaigcd4