Impact of Na+/Ca2+ Exchangers on Therapy Resistance of Ovary Carcinoma Cells

Lisann Pelzl, Zohreh Hosseinzadeh, Kousi Alzoubi, Tamer Al-Maghout, Sebastian Schmidt, Christos Stournaras, Florian Lang
2015 Cellular Physiology and Biochemistry  
Background/Aims: According to previous observations, enhanced store-operated Ca 2+ -entry (SOCE) accomplished by the pore forming ion channel unit Orai1 and its regulator STIM1 contribute to therapy resistance of ovary carcinoma cells. Ca 2+ signaling is further shaped by Ca 2+ extrusion through K + -independent (NCX) and/or K + -dependent (NCKX) Na + /Ca 2+exchangers. The present study thus explored whether therapy resistance is further paralleled by altered expression and/or function of Na +
more » ... r function of Na + /Ca 2+ -exchangers. Methods: In therapy resistant (A2780cis) and therapy sensitive (A2780sens) ovary carcinoma cells transcript levels were estimated from RT-PCR, cytosolic Ca 2+ -activity ([Ca 2+ ] i ) from Fura-2-fluorescence, Na + /Ca 2+exchanger activity from the increase of [Ca 2+ ] i (Δ[Ca 2+ ] i ) and from whole cell current (I ca ) following abrupt replacement of Na + containing (130 mM) and Ca 2+ free extracellular perfusate by Na + free and Ca 2+ containing (2 mM) extracellular perfusate, as well as cell death from PI -staining in flow cytometry. Results: The transcript levels of NCX3, NCKX4, NCKX5, and NCKX6, slope and peak of Δ[Ca 2+ ] i as well as I ca were significantly higher in therapy resistant than in therapy sensitive ovary carcinoma cells. The Na + /Ca 2+ -exchanger inhibitor KB-R7943 (10 µM) significantly blunted Δ[Ca 2+ ] i and significantly augmented the cisplatin-induced cell death of therapy resistant ovary carcinoma cells without significantly modifying cisplatin-induced cell death of therapy sensitive ovary carcinoma cells. Conclusion: Enhanced Na + /Ca 2+ -exchanger activity may contribute to the therapy sensitivity of ovary carcinoma cells. Introduction Alterations of cytosolic Ca 2+ activity contribute to the regulation of diverse cellular mechanisms, such as excitation, exocytosis, migration, cell proliferation and cell death [1] [2] [3] [4] [5] . Cytosolic Ca 2+ concentration ([Ca 2+ ] i ) is increased by several mechanisms including Ca 2+ release from intracellular stores with subsequent triggering of store operated Ca 2+ entry (SOCE) accomplished by Orai [6-10] and STIM [11] [12] [13] [14] [15] isoforms. Orai1 and STIM1 are expressed in and contribute to the survival of several tumor cells [16] [17] [18] [19] [20] including therapy resistant ovary carcinoma cells [21] . Cytosolic Ca 2+ activity is further modified by Ca 2+ extrusion accomplished by several mechanisms including Na + /Ca 2+ exchangers, which thus contribute to the shaping of duration, amplitude and intracellular location of Ca 2+ signals [22] [23] [24] . Na + /Ca 2+ exchangers operate with far higher turnover rates than Ca 2+ ATPases [25] . Six K + -dependent (NCKX) and three K + -independent (NCX) Na + /Ca 2+ exchanger isoforms have been identified [26] [27] [28] . NCX isoforms exchange three Na + ions for one Ca 2+ ion and NCKX isoforms exchange one K + ion and one Ca 2+ ion for four Na + ions [29] . The direction of transport by Na + /Ca 2+ exchangers depends on the electrochemical driving forces, i.e. the cell membrane potential, the Na + gradient and the Ca 2+ gradient [30] . The present study explored whether ovary carcinoma cells express Na + /Ca 2+ exchangers and whether Na + /Ca 2+ exchanger expression and function differs between therapy resistant and therapy sensitive ovary carcinoma cells. To this end, the transcript levels of the three NCX and six NCKX isoforms were quantified, Na + /Ca 2+ exchanger activity determined and the impact of NCX inhibition on cisplatin induced cell death analyzed. Materials and Methods Ethics Statement Investigation has been conducted in accordance with the ethical standards and according to the Declaration of Helsinki and according to national and international guidelines and has been approved by the authors' institutional review board. Cell culture Experiments were performed in cisplatin-resistant cells (A2780cis) and their therapy sensitive parent cells (A2780sens) (ECACC catalogue no. 93112519). A2780cis has been generated by exposure to increasing concentrations of cisplatin and is further resistant to melphalan, adriamycin and irradiation [31] [32] [33] . The cells were cultured in Dulbecco's RPMI media, containing 10% fetal calf serum and 1% antibiotic/ antimycotic solution. Where indicated, the cells were treated with cisplatin (100 µM) (Sigma, Taufkirchen, Germany) [21] or the NCX inhibitor [34] KB-R7943 (10 µM) (Sigma, Taufkirchen, Germany). Real-time PCR Total RNA was extracted from ovary carcinoma cells in TriFast (Peqlab, Erlangen, Germany) according to the manufacturer's instructions. After DNAse digestion reverse transcription of total RNA was performed using Transcriptor High Fidelity cDNA Synthesis Kit (Roche Diagnostics, Penzberg, Germany). Real-time polymerase chain reaction (RT-PCR) of the respective genes were set up in a total volume of 20 µl using 40 ng of cDNA, 500 nM forward and reverse primer and 2x GoTaq® qPCR Master Mix (Promega, Hilden, Germany) according to the manufacturer's protocol. Cycling conditions were as follows: initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec, 58°C for 15 sec and 68°C for 20 sec. For amplification the following primers were used (5'->3'orientation): for NCX1: fw: acaagaggtatcgagctggc, rev: atgccatttctcgcctagc; for NCX2: fw: cgctggtgttcaaaccag, rev: gacgaccacgcaggcat; for NCX3: fw: gcattgccagggtcattgtct, rev: ccataagggtcaggttggaga; for NCKX1: fw: tccacgcagaagatggtg, rev: gtgatggaggggatagcg; for NCKX2: fw: gagacagatacacagagcacagg, rev: gagaatagtacagatcacgccc;
doi:10.1159/000438547 pmid:26584285 fatcat:6qkmkdi7dbemfehrt5w4pbqr4e