Filters








11 Hits in 6.8 sec

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

Daniel Greuter, Alexander Loy, Matthias Horn, Thomas Rattei
<span title="2015-11-19">2015</span> <i title="Oxford University Press (OUP)"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/hfp6p6inqbdexbsu4r7usndpte" style="color: black;">Nucleic Acids Research</a> </i> &nbsp;
probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers.  ...  an important and frequently used resource for microbiology research and diagnostics.  ...  To date (September 2015), probeBase contains 2788 probes, 175 domain-specific PCR primers (18) and 16 microarrays from 499 publications and is an online resource that is frequently used by the scientific  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1093/nar/gkv1232">doi:10.1093/nar/gkv1232</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/26586809">pmid:26586809</a> <a target="_blank" rel="external noopener" href="https://pubmed.ncbi.nlm.nih.gov/PMC4702872/">pmcid:PMC4702872</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/psexeflnjrgixf52noc7bgjyhi">fatcat:psexeflnjrgixf52noc7bgjyhi</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20200810055654/https://services.phaidra.univie.ac.at/api/object/o:930761/diss/Content/download" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/ad/90/ad90b861b1d633eee9bfea6bdeee7387e2cfaacc.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1093/nar/gkv1232"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> oup.com </button> </a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4702872" title="pubmed link"> <button class="ui compact blue labeled icon button serp-button"> <i class="file alternate outline icon"></i> pubmed.gov </button> </a>

probeBase - an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

Daniel Greuter
<span title="">2017</span> <span class="release-stage">unpublished</span>
The new probe matching feature is powered by VMATCH.  ...  This function identifies near full-length rRNA equivalent for short query sequences.  ...  To date (September 2015), probeBase contains 2788 probes, 175 domain-specific PCR primers (18) and 16 microarrays from 499 publications and is an online resource that is frequently used by the scientific  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.25365/thesis.50026">doi:10.25365/thesis.50026</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/2ck6a574knekfprmxwg5t57hhy">fatcat:2ck6a574knekfprmxwg5t57hhy</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20200214021907/http://othes.univie.ac.at/50026/1/52810.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/60/00/6000c064f78afe2b1c165f6d3e69f9285089a77e.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.25365/thesis.50026"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> Publisher / doi.org </button> </a>

Novel prosthecate bacteria from the candidate phylum Acetothermia revealed by culture-independent genomics and advanced microscopy [article]

Li-Ping Hao, Simon Jon McIlroy, Rasmus Hansen Hansen Kirkegaard, Søren Micheal Karst, Warnakulasuriya Eustace Yrosh Fernando, Hüsnü Aslan, Rikke Louise Meyer, Mads Albertsen, Per Halkjær Nielsen, Morten Simonsen Dueholm
<span title="2017-10-24">2017</span> <i title="Cold Spring Harbor Laboratory"> bioRxiv </i> &nbsp; <span class="release-stage" >pre-print</span>
Genome annotation and metabolic reconstruction suggested an anaerobic chemoheterotrophic lifestyle in which the bacterium obtain energy and carbon via fermentation of peptides, amino acids, and simple  ...  In this study, an OTU belonging to Acetothermia was detected at high abundance in two full-scale anaerobic digesters.  ...  . & Rattei, T. probeBase-an online resource for rRNA-targeted 590 oligonucleotide probes and primers: new features 2016. Nucleic Acids Res. 44, D586-D589 (2016). 591 41.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1101/207811">doi:10.1101/207811</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/cclnqfimgrco7ih563qesbyro4">fatcat:cclnqfimgrco7ih563qesbyro4</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20190501143707/https://www.biorxiv.org/content/biorxiv/early/2017/10/24/207811.full.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/1f/09/1f09c44c6e880c3563a0417c1eeda3c0ff39c559.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1101/207811"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> biorxiv.org </button> </a>

Quantitative approaches for investigating the spatial context of gene expression

Je H. Lee
<span title="2016-12-21">2016</span> <i title="Wiley"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/2lnx26ozj5b2vhlg4bbckpx53i" style="color: black;">Wiley Interdisciplinary Reviews: Systems Biology and Medicine</a> </i> &nbsp;
requirements for making a visual map of gene regulation, form, and function.  ...  Successfully addressing these challenges will be essential for investigating the functional evolution of regulatory sequences during growth, development, and cancer progression.  ...  (a) The Nilsson method uses target-specific reverse transcription (RT) primers (typically locked nucleic acid (LNA) derivatives) to make cDNA molecules in situ used for padlock probebased T4 DNA ligation  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1002/wsbm.1369">doi:10.1002/wsbm.1369</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/28001340">pmid:28001340</a> <a target="_blank" rel="external noopener" href="https://pubmed.ncbi.nlm.nih.gov/PMC5315614/">pmcid:PMC5315614</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/b3yqjubnxbhavagj3v6cspbnyy">fatcat:b3yqjubnxbhavagj3v6cspbnyy</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20191110141144/http://europepmc.org/backend/ptpmcrender.fcgi?accid=PMC5315614&amp;blobtype=pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/cb/67/cb67154425ca0b3806ab7a8e55393b83c0416083.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1002/wsbm.1369"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> wiley.com </button> </a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5315614" title="pubmed link"> <button class="ui compact blue labeled icon button serp-button"> <i class="file alternate outline icon"></i> pubmed.gov </button> </a>

From Vineyard Soil to Wine Fermentation: Microbiome Approximations to Explain the "terroir" Concept

Ignacio Belda, Iratxe Zarraonaindia, Matthew Perisin, Antonio Palacios, Alberto Acedo
<span title="2017-05-08">2017</span> <i title="Frontiers Media SA"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/67anf6qgandy5adz4rakospiuq" style="color: black;">Frontiers in Microbiology</a> </i> &nbsp;
An overview of molecular and informatics tools is included and new directions are proposed, highlighting the importance of -omics technologies in wine research and industry.  ...  This soil-associated microbiota has been described as determinant, not only for the chemistry and nutritional properties of soils, but also for health, yield, and quality of the grapevine.  ...  In the same way, probeBase 1 is an additional online resource, providing the opportunity to evaluate the in silico hybridization performance of oligonucleotides, as well as finding suitable hierarchical  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.3389/fmicb.2017.00821">doi:10.3389/fmicb.2017.00821</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/28533770">pmid:28533770</a> <a target="_blank" rel="external noopener" href="https://pubmed.ncbi.nlm.nih.gov/PMC5420814/">pmcid:PMC5420814</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/ffdvqbblnvh55m2l7gqvmbygiy">fatcat:ffdvqbblnvh55m2l7gqvmbygiy</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20180721014659/http://eprints.ucm.es/44073/1/Belda.%202017.%20From%20vineyard%20soil%20to%20wine%20fermentation%20Microbiome%20approximations%20to%20explain%20the.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/0c/1b/0c1bccfe29dbfc62da99b57d4f3c2b959114b2b8.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.3389/fmicb.2017.00821"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> frontiersin.org </button> </a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5420814" title="pubmed link"> <button class="ui compact blue labeled icon button serp-button"> <i class="file alternate outline icon"></i> pubmed.gov </button> </a>

The microbiome driving anaerobic digestion and microbial analysis [chapter]

Jun Wei Lim, Tansol Park, Yen Wah Tong, Zhongtang Yu
<span title="">2020</span> <i title="Elsevier"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/anfnna6tbfhnxdnwaey7mxvgdu" style="color: black;">Advances in Bioenergy</a> </i> &nbsp;
In this chapter, we reviewed the utilities and limitations of these analysis methods, techniques, and technologies when they were used in studies of biogas-producing microbiomes, as well as the new information  ...  We also discussed the current knowledge gaps and the research needed to further improve AD efficiency and stability. 2 Jun Wei Lim et al.  ...  rRNA-targeted oligonucleotide probes as phylogenetic stains for cultivation-independent identification of microorganisms.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1016/bs.aibe.2020.04.001">doi:10.1016/bs.aibe.2020.04.001</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/67l5p6ecwvccnch2uwu46xmfkm">fatcat:67l5p6ecwvccnch2uwu46xmfkm</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20200507000521/https://pdf.sciencedirectassets.com/315554/AIP/1-s2.0-S2468012520300018/main.pdf?X-Amz-Security-Token=IQoJb3JpZ2luX2VjEHgaCXVzLWVhc3QtMSJGMEQCIHxIFW0%2FznvHGaOe1X5CEIMMfNl%2FxRtDv9uKIJOVN8p1AiALCViMrlwDUWLUCJumxSHpyqM2a0M7kydsh1FhxAPvviq9Awiw%2F%2F%2F%2F%2F%2F%2F%2F%2F%2F8BEAMaDDA1OTAwMzU0Njg2NSIMMXHicucVXSy4sYczKpED6PQecKybd%2FPL7NgSy21gk6oiSsTYdTgtwIHc2enjZWD9L1fAy11fhPNdSzle7V9w2XCgTAmi7ozqNPT3lOla84u4ThNjjUt%2FFnOgYACGN3P3DDW7fyRTi4ZEI3LaZMiIZjIXLRklHK2uuG5vb23MkBlCvXwIBVbjufngokVShQ5WWWhfli0Uspt6TMgzS%2F1ITklRyNAYICu7R79IqnAIzb5JNVK3d6ZYwTzwOdGpeLxB5upGlbq3pISfo19lFXOLw26weYFZP%2FT4h7G1W1NoI8tBH%2FFkwl%2FOvBjlgN%2F%2BqJa8Xthq2BilkBN2GiGxh0Eq%2Fk5PsNdF6YNcOM61C2dwlsngyCG8OZXAnBfPEe3pEzBCmQRbGLTKllTN35IiJ7VSEhdN4w%2Bz8q95qhoH%2BwAY71MsNeg53sWlkAKmaD8az%2FkQxFGe8nAGTrGakx2kLqapR1dZ0MOYJA8BQkilzTSImw3yBHMmFddy0w7rUQI5Xs7a8uzYzfRQiRLsjHH%2BmLKLpk568UNpe20LImFrMm1YxZcwtoXN9QU67AHkLJlQGCIqUf5CMVH%2B52CPsoR4R9xsFFVgLvmZBOPMu%2FafaYmWKkAIQmABgqvHenHmqHdDXm6I4Cnyw4PGvTAKIYlfiKis8ZePf0Ih8djeMO6YRQfcDVICGmt9F4ZwG4JrVhRp31J5krs0%2FXHChNwKZ3Xf4YY0Axva779Z1AEUKatn3HD28cxV6yoZa9%2BUfxe8zLxaup2K9mQ7zwp68XUJDbJIPS0HiajtQkShZiNznntnPP6w0dvqonNwcy8oiU1bkwP6Z84sGMDsvS%2FBIZ02E8XQzQdV185FvlcUetqBHuM1ZU8KJJKz8GPIhQ%3D%3D&amp;X-Amz-Algorithm=AWS4-HMAC-SHA256&amp;X-Amz-Date=20200507T000512Z&amp;X-Amz-SignedHeaders=host&amp;X-Amz-Expires=300&amp;X-Amz-Credential=ASIAQ3PHCVTYT5RYKOUN%2F20200507%2Fus-east-1%2Fs3%2Faws4_request&amp;X-Amz-Signature=2905344896f5c8c7256357ac05f478f4d7fd3bb1a93dff68c29aa18a33a7abf2&amp;hash=a635011260c68ade0cb59f76d1c25a59103efb0671018d1e439c9bb720d85f1e&amp;host=68042c943591013ac2b2430a89b270f6af2c76d8dfd086a07176afe7c76c2c61&amp;pii=S2468012520300018&amp;tid=spdf-c15ffdac-a6b8-4400-a0bf-ab285ee31860&amp;sid=9ee6eff9360c40401b0a0e337a365dad8bccgxrqa&amp;type=client" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/e6/d9/e6d9ce2efc3a39bd436ec4a61613c13356a2043d.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1016/bs.aibe.2020.04.001"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> elsevier.com </button> </a>

The biogeochemical vertical structure renders a meromictic volcanic lake a trap for geogenic CO2 (Lake Averno, Italy)

Franco Tassi, Stefano Fazi, Simona Rossetti, Paolo Pratesi, Marco Ceccotti, Jacopo Cabassi, Francesco Capecchiacci, Stefania Venturi, Orlando Vaselli, Antti Rissanen
<span title="2018-03-06">2018</span> <i title="Public Library of Science (PLoS)"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/s3gm7274mfe6fcs7e3jterqlri" style="color: black;">PLoS ONE</a> </i> &nbsp;
Powered by Editorial Manager® and ProduXion Manager® from Aries Systems Corporation  ...  Loy A, Maixner F, Wagner M, Horn M. probeBase -an online resource for rRNA-targeted 839 oligonucleotide probes: new features 2007. Nucleic Acids Research. 2007;35:D800-D804. 35 51.  ...  protocol optimized by Fazi et 217 al. [40-41]. rRNA-target Horseradish peroxidase (HRP) labeled oligonucleotidic probes (Biomers, 218 Ulm, Germany) were used to target Bacteria (EUB338 I-III), and Archaea  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1371/journal.pone.0193914">doi:10.1371/journal.pone.0193914</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/29509779">pmid:29509779</a> <a target="_blank" rel="external noopener" href="https://pubmed.ncbi.nlm.nih.gov/PMC5839588/">pmcid:PMC5839588</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/irqialvckfe2jifrbhue25yno4">fatcat:irqialvckfe2jifrbhue25yno4</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20190307100326/http://pdfs.semanticscholar.org/d4e6/e84eca5fc4a204b4af5bec16afc8ab9d7e56.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/d4/e6/d4e6e84eca5fc4a204b4af5bec16afc8ab9d7e56.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1371/journal.pone.0193914"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> plos.org </button> </a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5839588" title="pubmed link"> <button class="ui compact blue labeled icon button serp-button"> <i class="file alternate outline icon"></i> pubmed.gov </button> </a>

Virus Hunter

C.J. Peters
<span title="">1997</span> <i title="Centers for Disease Control and Prevention (CDC)"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/xfv7rdysezhxpa4oce7jejarnq" style="color: black;">Emerging Infectious Diseases</a> </i> &nbsp;
The dedication and cooperation of Papua New Guinea health officials working in TB control in the South Fly District and Port Moresby should be recognized.  ...  We also highly appreciate the comments and suggestions of Derry Stover and Kenneth Rosenman on an earlier version of this paper.  ...  For cluster A, we designed 1 selective primer (SNP2) to target the allele found in the cluster A strain, whereas the 2 remaining primers (SNP1 and SNP3) targeted the alternative alleles, as expected in  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.3201/eid0303.970330">doi:10.3201/eid0303.970330</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/vqeerodylbco3ayw5bhzi6lu6q">fatcat:vqeerodylbco3ayw5bhzi6lu6q</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20190426075918/https://wwwnc.cdc.gov/eid/content/25/3/pdfs/v25-n3.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.3201/eid0303.970330"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> Publisher / doi.org </button> </a>

D3.15- 3rd periodic report on JRPs [article]

Sciensano
<span title="2021-06-03">2021</span> <i title="Zenodo"> Zenodo </i> &nbsp;
Duration 60 Months DOCUMENT MANAGEMENT Title OHEJP deliverable D3.15 Third periodic report on JRP WP and task WP3 Leader Sciensano Other contributors ANSES Due month of the deliverable M39 Actual submission  ...  The oligonucleotide probe used in the CTX-M-1 LEC-LAMP was modified to contain a different fluorophore label to enable detection of the CTX-M-15 target, while differentiating CTX-M-1.  ...  The new approach will keep the same objectives but will make use of an updated view on implementation and required resources.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.5281/zenodo.4897319">doi:10.5281/zenodo.4897319</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/dtppotwzlrhzzbzrmm2lvpvqbi">fatcat:dtppotwzlrhzzbzrmm2lvpvqbi</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20210608023535/https://zenodo.org/record/4897319/files/D3.15-3rd-Periodic-Report-on-JRP-Final.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.5281/zenodo.4897319"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> zenodo.org </button> </a>

Engineering translational approaches for molecular diagnostics of cancer: Multifunctional nanomaterials and electrochemical sensors for clinically relevant RNA biomarker detection

Nazmul Islam, University, My, Muhammad Shiddiky
<span title="2018-05-09">2018</span>
This PhD project endeavours to engineer such translational approaches to circumvent the aforementioned challenges for developing an inexpensive, sensitive, specific, and portable biosensor platform.  ...  Improved diagnostics, prognostics and streamlined therapeutic potentiality makes them an excellent choice as biomarkers.  ...  Oligonucleotides sequences used in experiments View Article Online DOI: 10.1039/C7AN02109G 135 Oligos 5'-Sequences-3' HOTAIR Fwd Primer Sequence GGTAGAAAAAGCAACCACGAAGC HOTAIR Rev Primer Sequence  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.25904/1912/2549">doi:10.25904/1912/2549</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/7owtapvl7rfrtlbdgl6vex6qoi">fatcat:7owtapvl7rfrtlbdgl6vex6qoi</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20200815225916/https://research-repository.griffith.edu.au/bitstream/handle/10072/374754/Islam,%20Md%20Nazmul_Final%20Thesis_Redacted.pdf;jsessionid=C6D0F6A157CDFF7F18252980ED4E15C1?sequence=1" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/41/c6/41c6d36d186d3a41061ea433a4263762784111ea.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.25904/1912/2549"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> Publisher / doi.org </button> </a>

Assessment of Verticillium dahliae Kleb. And Soil Fungal Communities Associated with Strawberry Fields

Seyed Mahyar Mirmajlessi, Marika Mänd, Evelin Loit
<span title="">2017</span>
Additionally, finding new potential biocontrol agents was also important in terms of their implications for biological control.  ...  Strawberry (Fragaria × ananassa) is a high value crop, and it is grown for its berries in many countries.  ...  The authors thank Prof Peter Harley (National Center for Atmospheric Research, Colorado, USA) for critical reading of the manuscript and giving valuable comments for improving the quality of this work.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.15159/emu.13">doi:10.15159/emu.13</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/6cr3blw6tfalxnxatjhsugblyy">fatcat:6cr3blw6tfalxnxatjhsugblyy</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20220116222339/https://dspace.emu.ee/bitstream/handle/10492/3359/Mirmajlessi_PhD_2017.pdf;jsessionid=33171DF86624B281A244866FEC9736BE?sequence=1" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/f7/e5/f7e5a14da4d24893a546179cc2044f716ec21b9c.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.15159/emu.13"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> Publisher / doi.org </button> </a>