Filters








135 Hits in 1.3 sec

On Pedagogical Effects of Learner-Support Agents in Collaborative Interaction [chapter]

Yugo Hayashi
2012 Lecture Notes in Computer Science  
The present study was conducted to investigate if and how conversational agent can facilitate explanation activity that is conducive to learning. This was investigated through two experiments where pairs of participants, who were enrolled in a psychology course, engaged in a task of explaining to their partners the meanings of concepts of technical terms taught in the course. During the task, they interacted with a conversational agent, which was programmed to provide back-channel feedbacks and
more » ... annel feedbacks and meta cognitive suggestions to encourage and facilitate conversational interaction between the participants. The findings of the experiments suggested that (1) a conversational agent can facilitate a deeper understanding of conceptwhen participants are attentive to its presence, and (2) affective positive feedbacks from conversational agent facilitates explanation and learning performance.
doi:10.1007/978-3-642-30950-2_3 fatcat:tnw3souvyvfhjd7duaxyzuvwo4

Effects of Expertise in Learning From Examples

Akira URAO, Shintaro ITO, Shunsuke AOKI, Yugo HAYASHI
2011 Journal of JSEE  
HAYASHI Previous studies show that Worked-out examples improve more learning effects than simply solving problems in the initial stage of cognitive skill acquisition.  ...  ) , 10) .Product-oriented Worked-out example と,Process-oriented Worked-out example 平成 23 年5月 10 日受付 ※1鈴鹿工業高等専門学校 ※2立命館大学情報理工学部 熟達度の違いが例題学習の効果に及ぼす影響 Akira URAO Shintaro ITO Shunsuke AOKI Yugo  ... 
doi:10.4307/jsee.59.6_86 fatcat:7mt5pqgbl5hgzixa5ssfgo5vx4

Cognitive and Emotional Characteristics of Communication in Human-Human/Human-Agent Interaction [chapter]

Yugo Hayashi, Kazuhisa Miwa
2009 Lecture Notes in Computer Science  
To establish such a situation, we used an experimental paradigm designed by Hayashi, Miwa, and Morita [2] , in which two participants, each having a different perspective, communicate with each other.  ... 
doi:10.1007/978-3-642-02580-8_29 fatcat:vrvvmhkcvvfmzc2vduwdj75oqe

An Empirical Investigation of Similarity-driven Trust Dynamics in Social Networks

Yugo Hayashi, Victor Kryssanov
2013 Procedia - Social and Behavioral Sciences  
The experimental methodology was adopted from a previous study reported elsewhere (Hayashi, 2012) .  ... 
doi:10.1016/j.sbspro.2013.05.055 fatcat:sk2bvijbf5ayrnxbee6pczeqvm

Bex1 significantly contributes to the proliferation and invasiveness of malignant tumor cells

Takefumi Doi, Hiroyuki Ogawa, Yugo Tanaka, Yoshitake Hayashi, Yoshimasa Maniwa
2020 Oncology Letters  
Invasion has a significant role in cancer progression, including expansion to surrounding tissue and metastasis. Previously, we assessed the invasive ability of cancer cells using an easy-to-prepare double-layered collagen gel hemisphere (DL-CGH) method by which cancer cell invasion can be easily visualized. The present study examined multiple lung adenocarcinoma and malignant pleural mesothelioma (MPM) cell lines using the DL-CGH method and identified inherently invasive cell lines. Next, by
more » ... l lines. Next, by comparing gene expression between invasive and non-invasive cells by cDNA microarray, the potential candidate gene brain-expressed x-linked protein 1 (Bex1) was identified to be involved in cancer invasion, as it was highly expressed in the invasive cell lines. Downregulation of Bex1 suppressed the invasion and proliferation of the invasive tumor cell lines. The findings of the present study suggested that Bex1 may promote metastasis in vivo and could be a potential oncogene and molecular therapeutic target in lung adenocarcinoma and MPM.
doi:10.3892/ol.2020.12226 pmid:33133262 pmcid:PMC7590424 fatcat:zty3fhcnwre27jigztftay7yei

Domain swapping oligomerization of thermostable c-type cytochrome in E. coli cells

Yugo Hayashi, Masaru Yamanaka, Satoshi Nagao, Hirofumi Komori, Yoshiki Higuchi, Shun Hirota
2016 Scientific Reports  
S2 Materials and Methods Construction of HT cyt c 552 expression system. Insertion of a His-tag (GSGHHHHHH) at the C-termini of WT I76V, A5F/M11V, Y32F/Y41E, and A5F/M11V/Y32F/Y41E/I76V HT cyt c552 was performed by PCR-based in vitro mutagenesis of the plasmid DNA coding HT cyt c552 with a KOD Plus mutagenesis kit (TOYOBO) using forward (GGCTCGGGCCATCATCATCATCATCATTAAGTCGACCTGCAGCCAAGCTT) and reverse primers (CTTTATGGAGAGTATCCACTGGGC for WT, A5F/M11V, and Y32F/Y41E HT cyt c552;
more » ... 2; CTTTATGGAGAGTACCCACTGGGC for I76V and A5F/M11V/Y32F/Y41E/I76V HT cyt c552). The plasmid DNAs were enhanced with DH5α cells, and transformed into E. coli JCB387 containing the pEC86 plasmid DNA 1 . Purification of HT cyt c 552 . The cultured E. coli cells were suspended with 25 mM acetic acid buffer, pH 5.0, and centrifuged (13,700 g, 10 min, 4 °C). The cells were suspended again with 100 mM Tris-HCl buffer, pH 8.0, containing 10 mM EDTA and 20% (w/v) sucrose, and subsequently incubated on ice for 1 h and centrifuged (13,700 g, 10 min, 4 °C). The cells were finally suspended with 100 mM potassium phosphate buffer, pH 7.0, freeze-thawed, and centrifuged (13,700 g, 10 min, 4 °C). Streptomycin (1% w/v, Nacalai tesque) was added to the supernatant, and the solution was incubated on ice for 30 min and subsequently centrifuged (13,700 g, 10 min, 4 °C). The solution was dialyzed overnight at 4 °C with 10 mM potassium phosphate buffer, pH 7.0, containing 1 mM streptomycin. Oxidized HT cyt c552 was prepared by an addition of 50 mM potassium ferricyanide to the sample solution (final concentration, 50 μM), and purified with a CM Sepharose (Wako) column. The elution solution containing oligomeric HT cyt c552 was analyzed by size exclusion chromatography (column: Hiload 16/600 Superdex75 pg or Superdex 75 10/300 GL, GE Healthcare) using a FPLC system (BioLogic DuoFlow 10, Bio-Rad) as reported 2 . SDS-PAGE was performed with 18% gel for the fractions obtained by size exclusion chromatography. The gels were heme-stained with 3,3',5,5'-tetramethylbenzidine (TCI, Tokyo, Japan) and hydrogen peroxide for detection of heme c 3 . WT and A5F/M11V/Y32F/Y41E/I76V HT cyt c552 without a His-tag were purified with a CM Sepharose (Wako) column and size exclusion chromatography (column: Hiload 26/600 Superdex75 pg, GE Healthcare) using the FPLC system (BioLogic DuoFlow 10, Bio-Rad) as reported 2 . His-tagattached WT, I76V, A5F/M11V, Y32F/Y41E, and A5F/M11V/Y32F/Y41E/I76V HT cyt c552 were extracted from E. coli by freeze-thaw and sonication. The amount of extracted His-tag-attached HT cyt c552 was estimated by the pyridine hemochrome method 4 . The His-tag-attached HT cyt c552 were purified with a HisTrap HP column (GE Healthcare) using the FPLC system (BioLogic DuoFlow 10, Bio-Rad) (flow rate, 1.0 mL/min; monitoring wavelength, 280 nm and 410 nm; gradient, 25 mM Tris-HCl buffer, pH 8.0, containing 0.5 M NaCl and the same buffer containing 0.5 M NaCl and 0.5 M imidazole; temperature, 4 °C). E. coli JCB387 not containing pKO2 and pEC86 plasmid DNAs was cultured to investigate the effect of freeze-thaw on oligomerization.
doi:10.1038/srep19334 pmid:26838805 pmcid:PMC4738263 fatcat:u2fyjwojsbgx5intzwrugregey

Structure elements can be predicted using the contact volume among protein residues

Yasumichi Takase, Yoichi Yamazaki, Yugo Hayashi, Sachiko Toma-Fukai, Hironari Kamikubo
2021 Biophysics and Physicobiology  
Previously, the structure elements of dihydrofolate reductase (DHFR) were determined using comprehen-sive Ala-insertion mutation analysis, which is assumed to be a kind of protein "building blocks." It is hypo-thesized that our comprehension of the structure elements could lead to understanding how an amino acid sequence dictates its tertiary structure. However, the comprehensive Ala-insertion mutation analysis is a time- and cost-consuming process and only a set of the DHFR structure elements
more » ... structure elements have been reported so far. Therefore, developing a computational method to predict structure elements is an urgent necessity. We focused on intramolecular residue-residue contacts to predict the structure elements. We introduced a simple and effective parameter: the overlapped contact volume (CV) among the residues and calculated the CV along the DHFR sequence using the crystal structure. Our results indicate that the CV profile can recapitulate its precipitate ratio profile, which was used to define the structure elements in the Ala-insertion mutation analysis. The CV profile allowed us to predict structure elements like the experimentally determined structure elements. The strong correlation between the CV and precipitate ratio profiles indicates the importance of the intramolecular residue-residue contact in maintaining the tertiary structure. Additionally, the CVs between the structure elements are considerably more than those between a structure element and a linker or two linkers, indicating that the structure elements play a funda-mental role in increasing the intramolecular adhesion. Thus, we propose that the structure elements can be considered a type of "building blocks" that maintain and dictate the tertiary structures of proteins.
doi:10.2142/biophysico.bppb-v18.006 pmid:33954082 pmcid:PMC8049775 fatcat:6kik7rcjgjdhfca6b3n7ahxn4i

Psychological Characteristics on Communication with a Conversational Agent

Yugo HAYASHI, Eric COOPER, Victor KRYSSANOV, Akira URAO, Hitoshi OGAWA
2012 Transactions of Japan Society of Kansei Engineering  
doi:10.5057/jjske.11.459 fatcat:hdzrj2hx2rg3nblme7acqdu2fe

異なる視点に基づく協同問題解決に関する実験的検討
A Laboratory Study on Collaborative Problem Solving by Taking Different Perspectives

Yugo Hayashi, Kazuhisa Miwa, Junya Morita
2007 Cognitive Studies  
"Two Heads are better than one" "The more the merrier" A Laboratory Study on Collaborative Problem Solving by Taking Different Perspectives, by Yugo Hyashi, Kazuhisa Miwa (Graduate School of Information  ... 
doi:10.11225/jcss.14.604 fatcat:wni5jf43zjg7nhx7p3vox5ekdy

Enhancement of photoluminescence from silicon nanocrystals by metal nanostructures made by nanosphere lithography

Yugo Mochizuki, Minoru Fujii, Shinji Hayashi, Takaaki Tsuruoka, Kensuke Akamatsu
2009 Journal of Applied Physics  
The effect of metal nanostructures prepared by nanosphere lithography on photoluminescence ͑PL͒ properties of silicon nanocrystals ͑Si-ncs͒ is studied. By placing Ag nanotriangles or Au nanovoids on SiO 2 films containing Si-ncs, the PL intensity is enhanced. For the sample having Ag nanotriangles, the largest PL enhancement is obtained when the excitation wavelength coincides with the absorption band of Ag nanotriangles. This suggests that the enhancement of the incident field by surface
more » ... ld by surface plasmon polariton ͑SPP͒ excitation is responsible for the PL enhancement. On the other hand, for the sample having Au nanovoids, the PL enhancement is mainly made by the enhancement of effective radiative decay rate of Si-ncs by efficient excitation and scattering of SPPs.
doi:10.1063/1.3159030 fatcat:jzpkenaksnfzvdxpjltary362a

Enhancement of photoluminescence from excitons in silicon nanocrystals via coupling to surface plasmon polaritons

Eiji Takeda, Minoru Fujii, Toshihiro Nakamura, Yugo Mochizuki, Shinji Hayashi
2007 Journal of Applied Physics  
The enhancement of photoluminescence ͑PL͒ is demonstrated from silicon nanocrystals ͑Si-ncs͒ by strong coupling of excitons to surface plasmon polaritons ͑SPPs͒ supported by a Au thin film. SPPs excited via excitons in Si-ncs were Bragg scattered to photons by one-or two-dimensional gratings, and strong and directional PL was obtained. From the angular dependence of PL spectra, dispersion relations of electromagnetic modes involved in the light emission process were obtained. The overall
more » ... The overall agreement between experimentally obtained and theoretically calculated dispersion relations confirmed that the strong and directional PL is mediated by SPPs. The PL decay rate of Si-ncs increased by placing a Au thin film on top and the wavelength dependence of the rate enhancement agreed well with that of the calculated SPP excitation rate. This suggests that the observed PL enhancement is due to efficient energy transfer from excitons to SPPs followed by efficient scattering of SPPs to photons, resulting in the enhancement of luminescence quantum efficiency.
doi:10.1063/1.2753571 fatcat:ntxjetyx5zapbdr5kq5viks22a

NUMERICAL STUDY ON THE SEAWALL'S EFFECT AGAINST TSUNAMI RUN-UP AT MALE' ISLAND

Fuminori KATO, Masaya FUKUHAMA, Yasuro OHTANI, Yugo IMAZU, Takuya SAKAWA, Kentaro HAYASHI
2006 PROCEEDINGS OF HYDRAULIC ENGINEERING  
Male' Island, the capital of Maldives, was hit by Indian Ocean Tsunami on December 26 2004, but the damage was less severe in comparison with other islands in Maldives and neighbor countries. One of the major reasons was attributed to the solid seawalls surrounding the island. In this study, the effects of the seawalls were inspected by numerical simulation, in which the finest grid size was 3.33m for the whole Male' Island. The results indicated that Male' Island without seawalls would have
more » ... walls would have been hit by run-up flows with higher energy several times, especially on the east coast facing to the tsunami source. Thus it is certain that the existing seawalls reduced the damage of Male' Island as long as this event. In fact, the maximum tsunami height in Maldives, however, was relatively small, approx. 2m, so that the existing seawalls worked well against the tsunami. So it may be needed to implement other software methods; forecast and alert system, evacuation guideline system etc., as well as shore protection structures in preparation for larger scale tsunamis.
doi:10.2208/prohe.50.1423 fatcat:pfeb6tp7sbc4xbiqazgmzrskfu

Spraying Ozonated Water under Well-Ventilated Conditions Does Not Cause Any Visible Injury to Fruit-Vegetable Seedlings

Kazuhiro Fujiwara, Yugo Hayashi, Jong-Seok Park
2011 Ozone : Science & engineering  
doi:10.1080/01919512.2011.548685 fatcat:icztq7jbgbajrasn4qwo5i6j3u

Lexical Network Analysis on an Online Explanation Task: Effects of Affect and Embodiment of a Pedagogical Agent

Yugo HAYASHI
2016 IEICE transactions on information and systems  
Yugo HAYASHI †a) , Member SUMMARY The present study investigated the performance of textbased explanation for a large number of learners in an online tutoring task guided by a Pedagogical Conversational  ...  Hayashi received his M.S. and Ph.D. in Information Science from Nagoya University (Nagoya, Japan) in 2006 and 2009 respectively.  ... 
doi:10.1587/transinf.2015cbp0005 fatcat:brb7ein6mjeptnsyoxfto6yale

Spectroscopic and structural characteristics of a dual-light sensor protein, PYP-phytochrome related protein

Jia-Siang Sum, Yoichi Yamazaki, Keito Yoshida, Kento Yonezawa, Yugo Hayashi, Mikio Kataoka, Hironari Kamikubo
2020 Biophysics and Physicobiology  
PYP-phytochrome related (Ppr) protein contains the two light sensor domains, photoactive yellow protein (PYP) and bacteriophytochrome (Bph), which mainly absorb blue and red light by the chromophores of p-coumaric acid (pCA) and biliverdin (BV), respectively. As a result, Ppr has the ability to photoactivate both domains together or separately. We investigated the photoreaction of each photosensor domain under different light irradiation conditions and clarified the inter-dependency between
more » ... endency between these domains. Within the first 10 s of blue light illumination, Ppr (Holo-Holo-Ppr) accompanied by both pCA and BV demonstrated spectrum changes reflecting PYPL accumulation, which can also be observed in Ppr containing only pCA (Holo-Apo-Ppr), and a fragment of Ppr lacking the C-terminal Bph domain. Although Holo-Apo-Ppr showed PYPL as a major photoproduct under blue light, as seen in the Bph-truncated Ppr, the equilibrium in the Holo-Holo-Ppr was shifted from PYPL to PYPM as the reaction progresses under blue light. Concomitantly, the spectrum of Bph exhibited subtle but distinguishable alteration. Together with the fact, it can be proposed that Bph with BV influences the photoreaction of PYP in Ppr, and vice versa. SAXS measurements revealed substantial tertiary structure changes in Holo-Holo-Ppr under continuous blue light irradiation within the first 5 min time domain. Interestingly, the changes in tertiary structure were partially suppressed by photoactivation of the Bph domain. These observations indicate that the photoreactions of the PYP and Bph domains are coupled with each other, and that the interplay realizes the structural switch, which might be involved in downstream signal transduction.
doi:10.2142/biophysico.bsj-2020015 pmid:33194513 pmcid:PMC7610063 fatcat:wltwk4hnirfxflldr2sh3xpkhm
« Previous Showing results 1 — 15 out of 135 results