Filters








23 Hits in 4.4 sec

Ambiguity in Partnerships*

David Kelsey, Willy Spanjers
2004 Economic Journal  
A class of sharing rules are proposed that make constructive use of strategic ambiguity in partnerships. Results on ex-ante e±ciency and ex-post e±ciency of the outcomes are presented.  ...  The consequences of ambiguity for partnerships are addressed. Partnerships with symmetric linear production functions are analysed in a Choquet Expected Utility (CEU)framework.  ...  Theorem 5. 43 In the game induced by the entrepreneurial sharing rule, there exists an equilibrium in pure beliefs ((s ¤ k ) k2N ; (º ¤ k ) k2N ); with (i) ª e º ¤ 1 ([e s ¡1 ; !)  ... 
doi:10.1111/j.1468-0297.2004.00230.x fatcat:b23y3zgrvbhk7gy45zrrm2nirm

Generalized approach for the realization of discrete cosine transform using cyclic convolutions

Y.-H. Chan, W.-C. Siu
1993 IEEE International Conference on Acoustics Speech and Signal Processing  
A general solution is proposed to realize the discrete cosine transform of any length via cyclic convolutions in this paper.  ...  This algorithm is not optimal in minimizing any measure of computational complexity, but it involves some regular forms that are most suitable for the realization using technologies and structures which  ...  , {T(k)} can be obtained by 1 k2n T(k) = 2 (X(k)+X(2N-k)) sec-2N for k=O,1 ...  ... 
doi:10.1109/icassp.1993.319489 dblp:conf/icassp/ChanS93 fatcat:mcgay6k57nfhpdsftoxbdzll64

A Dynamic Non-Direct Implementation Mechanism for Interdependent Value Problems, Second Version

Richard P. McLean, Andrew Postlewaite
2015 Social Science Research Network  
Much of the literature on mechanism design and implementation uses the revelation principle to restrict attention to direct mechanisms. This is without loss of generality in a well de...ned sense.  ...  It is, however, restrictive if one is concerned with the set of equilibria, if one is concerned about the size of messages that will be sent, or if one is concerned about privacy.  ...  Stage 1: Each agent i learns his type t i 2 T i and makes a (not necessarily honest) report r i 2 A i of his signal to the mechanism designer.  ... 
doi:10.2139/ssrn.2624627 fatcat:pe642cynfbas3pzenjf4lj4o7u

A simple approximation to minimum-delay routing

Srinivas Vutukury, J. J. Garcia-Luna-Aceves
1999 Proceedings of the conference on Applications, technologies, architectures, and protocols for computer communication - SIGCOMM '99  
, searching existing data sources, gathering and maintaining the data needed, and completing and reviewing the collection of information.  ...  Report Documentation Page Form Approved OMB No. 0704-0188 Public reporting burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions  ...  Assuming that the network does not lose any packets, from conservation of traffic we have t i j = r i j + X k2N i t k j k ji (1) where N i is the set of neighbors of router i.  ... 
doi:10.1145/316188.316227 dblp:conf/sigcomm/VutukuryG99 fatcat:6czl34z72fb6vpjj3dsjg4q6ce

A simple approximation to minimum-delay routing

Srinivas Vutukury, J. J. Garcia-Luna-Aceves
1999 Computer communication review  
, searching existing data sources, gathering and maintaining the data needed, and completing and reviewing the collection of information.  ...  Report Documentation Page Form Approved OMB No. 0704-0188 Public reporting burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions  ...  Assuming that the network does not lose any packets, from conservation of traffic we have t i j = r i j + X k2N i t k j k ji (1) where N i is the set of neighbors of router i.  ... 
doi:10.1145/316194.316227 fatcat:fmxm5wfgkjbvzcultith5jyvyq

BamI, KpnI, and SalI restriction enzyme maps of the DNAs of herpes simplex virus strains Justin and F: occurrence of heterogeneities in defined regions of the viral DNA

H Locker, N Frenkel
1979 Journal of Virology  
We present the locations of the cleavage sites for the BamI, KpnI, and SalI restriction endonucleases within the DNA molecules of herpes simplex virus type 1 (HSV-1) strains Justin and F.  ...  The mapping data revealed the occurrence of heterogeneity within three regions of the viral genome including (i) the region spanning map coordinates 0.74-0.76, (ii) the ends of the large (L) DNA component  ...  This study was supported by Public Health Service Research grants AI-15488 and CA-19264 from the National Institutes of Health and by National Science Foundation grant PCM78-16298.  ... 
doi:10.1128/jvi.32.2.429-441.1979 fatcat:4scumswsx5brfj7qh6gornyy4y

Apparent discontinuous transcription of Trypanosoma brucei variant surface antigen genes

David A. Campbell, Deborah A. Thornton, John C. Boothroyd
1984 Nature  
The strategy and sequence obtained are shown in Figs I and 2, respectively. This demonstrated unambiguously that pMEP.I contains a portion of the mini-exon repeat.  ...  As the mini-exon should include an RsaI site, nucleotide sequence analysis in the vicinity of this site was performed on one of the plasmids (pMEP.1).  ...  1 T A TT TTTGGGACACAGCCATGCTTTCAACTiAACGCT AT TA TT AGMCAGTTTC TGT AC T A Pvu I I Fig. 2 2 -CTGCCGCA T AC TGCGGGAATCTGGAAGGTGGGGTCGGA TGACC TCCACTCTT T TT A TT T T Sau 3A , TTTT A TTTTT TTCA TTT A TTT  ... 
doi:10.1038/311350a0 pmid:6090933 fatcat:dwzaxcrtarecpkiowbs2q76fe4

De-Synchronized Clocks in Preemption Games with Risky Prospects

Andrei Barbos
2012 Social Science Research Network  
This result no longer holds when the increase in the measure of players leads to a decrease in the degree of clock synchronization in the game.  ...  The players' clocks are de-synchronized in that they learn of the investment opportunity at di¤erent times.  ...  [ k2N [ 2k+1 ; 2k+2 ) , where = b + k , for 2 [ 2k ; 2k+2 ), or (b) s ; s + , for 2 [ k2N [ 2k ; 2k+1 ) , and hs i, for 2 [ k2N [ 2k+1 ; 2k+2 ) , where = b + (k 1) , for 2 [ 2k ; 2k+2 ).  ... 
doi:10.2139/ssrn.2074815 fatcat:6kidfvdlojfgfmwl3jmdfma7uy

A high-order, fast algorithm for scattering calculation in two dimensions

J.C. Aguilar, Yu Chen
2004 Computers and Mathematics with Applications  
We will demonstrate the performance of the algorithm for scatterers of complex structures and at large wave numbers.  ...  ; therefore, the application of these operators to an arbitrary vector, required by an iterative method for the solution of the discretized linear system, will cost N2 log (N) for a N-by-N mesh, with the  ...  It was used 11 x 11 Gaussian functions to generate the scatterer function 4, and eight points per wavelength. 1 k 1 P, 1 Order 1 &-Relative Error I Iterations of GMRES(15) I CPU (seconds) 1 I 50  ... 
doi:10.1016/s0898-1221(04)90001-6 fatcat:d22qc7b7i5gonp6lwzcsjo45rq

On the consistency of a physical mapping method to reconstruct a chromosome in vitro

M Xiong, H J Chen, R A Prade, Y Wang, J Griffith, W E Timberlake, J Arnold
1996 Genetics  
, there exists a staircase of DNA fragments across the chromosomal region of interest.  ...  By doing so, we prove epi-convergence of the physical mapping model and epi-convergence of the physical mapping method.  ...  We also thank the reviewers for an opportunity to strengthen the manuscript. This work was supported by National Institutes of Health grant GM-52925 and National Science Foundation BIR-9422896.  ... 
pmid:8770604 pmcid:PMC1206956 fatcat:gcon6nu4dfh3zduyvhkeuvj4rq

L-type voltage-gated calcium channels: understanding function through structure

Ming-Chuan Wang, Annette Dolphin, Ashraf Kitmitto
2004 FEBS Letters  
This article considers each of the VGCC structures in terms of similarities and di¡erences with an emphasis upon translation of data into a biological context.  ...  There are some discrepancies between the structures, as well as reports for both monomeric and dimeric forms of the channel.  ...  The cardiac L-type calcium channel is assembled from three tissue-speci¢c isoforms of K 1 (K 1 1.2), K2N 1 , and L (largely the L 2 and L 3 isoforms) with no evidence as yet for a cardiac Q polypeptide  ... 
doi:10.1016/s0014-5793(04)00253-4 pmid:15111104 fatcat:6rl574dztzgyhdqmiywo2qzlbe

Replicated data types

Sebastian Burckhardt, Alexey Gotsman, Hongseok Yang, Marek Zawirski
2014 SIGPLAN notices  
We also present a novel technique for obtaining lower bounds on the worstcase space overhead of data type implementations and use it to prove optimality of 4 implementations.  ...  We apply it to 7 existing implementations of 4 data types with nontrivial conflictresolution strategies and optimizations (last-writer-wins register, counter, multi-value register and observed-remove set  ...  Gotsman was supported by the EU FET project ADVENT, and Yang by EPSRC.  ... 
doi:10.1145/2578855.2535848 fatcat:kqp64fywpjfxldgroehjhy7bia

A Coalescence-Guided Hierarchical Bayesian Method for Haplotype Inference

Yu Zhang, Tianhua Niu, Jun S. Liu
2006 American Journal of Human Genetics  
for all the parameters of interest.  ...  A Markov chain-Monte Carlo scheme is designed to draw from this posterior distribution.  ...  National Science Foundation grant DMS-0204674, and grant 10228102 from the National Natural Science Foundation of China.  ... 
doi:10.1086/506276 pmid:16826521 pmcid:PMC1559491 fatcat:luzs4xifebebrodf3sort2vlya

Pyridine Based Antitumour Compounds Acting at the Colchicine Site

R. Álvarez, L. Aramburu, P. Puebla, E. Caballero, M. González, A. Vicente, M. Medarde, R. Peláez
2016 Current Medicinal Chemistry  
The design principles behind the structural modifications and the achieved effect on the biological activity upon inclusion of these heterocycles are also discussed.  ...  Antimitotics binding at the colchicine site of tubulin are important antitumour and vascular disrupting agents.  ...  [35] On the contrary, pyridopyrazines, such as K2N (10) and G2N (9) occupy Zones 2 and 3 without binding to Zone 1.  ... 
doi:10.2174/092986732311160420104823 pmid:27117490 fatcat:wfuurrmhyrd3ncz5fqdaape2vq

Graph-theoretic connectivity control of mobile robot networks

M. M. Zavlanos, M. B. Egerstedt, G. J. Pappas
2011 Proceedings of the IEEE  
and hybrid systems that maintain communication links or control the network topology in a least restrictive manner.  ...  Common to these approaches is the use of mobility to control the topology of the underlying communication network.  ...  not known to robot i, i.e., ½: i kl ¼ 1; the ðk; lÞth entry of Term II with k ¼ i or l ¼ i is equal to 1 if there does not exist an active link between robots k and l, i.e., ½: i kl ¼ 1, and is always  ... 
doi:10.1109/jproc.2011.2157884 fatcat:amqz6an2vbggxj777y75mleog4
« Previous Showing results 1 — 15 out of 23 results