Filters








346 Hits in 1.8 sec

Markov Chains In Predictive Models of Currency Crises - With Applications to Southeast Asia

Roberto S. Mariano, Abdul G. Abiad, Bulent Gultekin, Tayyeb Shabbir, Augustine H.H. Tan
2002 Social Science Research Network  
probability law: Pr(S t = 0 S t-1 = 0) = p t and Pr(S t = 1 S t-1 = 1) = q t .  ...  pressures (S t = 1).  ... 
doi:10.2139/ssrn.313837 fatcat:uyplsnk2bbfnfflfyy2hmotk4u

Risk factors associated with malaria infection identified through reactive case detection in Zanzibar, 2012–2019

Humphrey R. Mkali, Erik J. Reaves, Shabbir M. Lalji, Abdul-Wahid Al-mafazy, Joseph J. Joseph, Abdullah S. Ali, Faiza B. Abbas, Mohamed H. Ali, Wahida S. Hassan, Chonge Kitojo, Naomi Serbantez, Bilali I. Kabula (+6 others)
2021 Malaria Journal  
Funding This study was made possible through support provided to the RTI International throughOkoa Maisha Dhibiti Malaria(OMDM) activity (Cooperative agreement number 72062118CA-00002) by the President' s  ... 
doi:10.1186/s12936-021-04025-1 pmid:34952596 pmcid:PMC8710018 fatcat:uy2eeb4pyjabheuutngabqcetq

Reverse transcriptase loop-mediated isothermal amplification (RT-LAMP)-based diagnosis: A potential alternative to quantitative real-time PCR based detection of the novel SARS-COV-2 virus

Farhan Haq, Salmaan Sharif, Adnan Khurshid, Aamer Ikram, Imran Shabbir, Muhammad Salman, Abdul Ahad, Muhammad Suleman Rana, Aroosha Raja, Nazish Badar, Hanaa Tashkandi, Turki Al Amri (+4 others)
2020 Saudi Journal of Biological Sciences  
For the RT-LAMP assay, three genes (orf-1ab, N, and S) were identified as the target sites for the detection of COVID-19.  ...  gene S-123F3 TCTATTGCCATACCCACAA S-123B3 GGTGTTTTGTAAATTTGTTTGAC S-123FIP CATTCAGTTGAATCACCACAAATGTGTGTTACCACAGAAATTCTACC S-123BIP GTTGCAATATGGCAGTTTTTGTACATTGGGTGTTTTTGTCTTGTT S-123LF ACTGATGTCTTGGTCATAGACACT  ...  Amplification of COVID-19 positive samples showed a pronounced change in color from pink to yellow for Orf-1ab, N, and S genes (Fig. 1) .  ... 
doi:10.1016/j.sjbs.2020.10.064 pmid:33424386 pmcid:PMC7785420 fatcat:ot4uq7lvd5fmxoc6afm25v7oru

Page 411 of The Month Vol. 24, Issue 10 [page]

1991 The Month  
See Mohammad S. Raza, Islam in Britain: Past, Present and the Future, Volcano Press Ltd., Leicester, 1991. . Shabbir Akhtar, Be Careful With Muhammad! The Salman Rushdie Affair, Bellew, London, 1989.  ...  Abdul Wahid Hamid, Js/am, the Natural Way, Muslim Education & Literary Services, London, for Muslim World League, Mecca, 1989.  ... 

A Crital Review of Islamic and Conventional Banking in Digital Era: A Case of Pakistan

Dr. Muzaffar Asad, Israr Ahmad, Syed Hussain Haider, Dr. Rabia Salman
2018 International Journal of Engineering & Technology  
Journal of Banking & Finance(24), 985-1004. doi:10.1016/S0378-4266(99)00115-6 [13] Faisal, M., Shabbir, M. S., Javed, S., & Shabbir, M. F. (2016).  ...  , Salman, & Hafeez, 2018) [ 1 ] 1 Abdul-Majid, M., Saal, D.  ... 
doi:10.14419/ijet.v7i4.7.20382 fatcat:xvbbkxowwren7lsdlskxyul5lu

Job Satisfaction amongst Nigerian Ophthalmologists: An Exploratory Study

CO Omolase, MA Seidu, BO Omolase, DE Agborubere
2010 Libyan Journal of Medicine  
Jamal Abdul Nasir, Andrew Hinde and M.H. Tahir (2011).  ...  Zawar Hussain, Javid Shabbir and M.H.Tahir (2011). On estimation of mean and sensitivity level of a sensitive variable in complex surveys.  ... 
doi:10.4176/091010 pmid:21483551 pmcid:PMC3066771 fatcat:dibadmgbf5f53gbhh7zncctcfa

Page 193 of National Union Catalog Vol. 31, Issue [page]

1958 National Union Catalog  
Mohamed Abdul Hakeem see Hakeem, Mohamed Abdul, 1926- Mohamed Abada see Abada, Mohamed, 1930- Mohamed Abdullah see Abdullah, Mohammad, Sheikh, 1905- Mohamed Adel A Hassan see Hassan, manned Adel A M 1926  ...  Mohamed Samin Uddin Khan see Khan, Mohamed Samin Uddin, 1928- Mohamed Shabbir Khan ace Khan, Mohamed Shabbir, 1924- Mohamed Sherif Adel see Adel, Mohamed Sherif, 1926- Mohamed V, Sw/tan of Morocco Muhammad  ... 

Overview of the interactive task in BioCreative V

Qinghua Wang, Shabbir S. Abdul, Lara Almeida, Sophia Ananiadou, Yalbi I. Balderas-Martínez, Riza Batista-Navarro, David Campos, Lucy Chilton, Hui-Jou Chou, Gabriela Contreras, Laurel Cooper, Hong-Jie Dai (+44 others)
2016 Database: The Journal of Biological Databases and Curation  
Overall users had a satisfactory experience with the system(s) they tested, and in terms of performance and usability measures, a few systems have been consistent throughout the evaluation and seem to  ... 
doi:10.1093/database/baw119 pmid:27589961 pmcid:PMC5009325 fatcat:ldpn6gjxircjlibqtysi57cztq

Problems of Translating the Anthropomorphic Images of Istwâ', the Face and the Eye in the Qur'ân into English

2015 Egyptian Journal of Linguistics Translation  
However, Abdul Haleem and Shabbir render it as "seeking His approval", yet Shakir's translation is "Desiring His goodwill".  ...  English Works Cited A-English Sources Abdul Haleem, M. A. S. (2001) ‫الثعالبي‬ ُ ، ُ ‫عبدالرحمن‬ ُ ‫بن‬ ُ ‫محمد‬ ُ ‫بن‬ ُ ‫مخلوف‬ ُ ‫أبي‬ ُ ‫زيد‬ (ُ. 1997 ُ.) ‫  ...  Concerning the second verse, the translation of Shabbir "[In Our eyes = Under God's affectionate support and care]".  ... 
doi:10.21608/ejlt.2015.224633 fatcat:vuhzvgkp5fd53bwetieiwg7fea

FINANCIAL LITERACY, DEMOGRAPHIC DIFFERENCES AND FINANCIAL RISK TOLERANCE LEVEL: A CASE STUDY

Ernie Hendrawaty, Nisrul Irawati, Isfenti Sadalia
2020 Journal of Security and Sustainability Issues  
., Binti Abdul Hamid, S. N., Shabbir, M. S., Salman, R., & Jian, Z. 2018 , & Jabarullah, N. H., Shabbir, M. S., Abbas, M., Siddiqi, A. F., & Berti, S. 2019 & Shabbir, M. S., Shariff, M. N.  ...  S., Imran, M., Raza, A., & Salman, R. 2019). M., Binti Aziz, A., Binti Abdul Hamid, S. N., Shabbir, M. S., Salman, R., & Jian, Z. 2018), (Shabbir, M.  ... 
doi:10.9770/jssi.2020.9.m(15) fatcat:bvu56bzecffjtdr6wrnbv2f224

Table of contents

2020 2020 IEEE 5th International Symposium on Telecommunication Technologies (ISTT)  
Syed-Yusof, Wajahat Maqbool, Nurul Mu'azzah Abdul Latiff, Bushra Naeem, Nik Noordini Nik Abd Malik and Bilal Shabbir Shabbir On the Area Expected Distortion of Scalable Videos in Multi-Frequency System  ...  J Jochen, Stellwagen S1-1 K Karthiyayeni, Govindasamy S2-2 Khaldon, Kordi S1-2 M Mohamad Kameel, Mohamad Afiif S2-2 N Naim Nani Fadzlina S1-1 Nik Abd Malik, Nik Noordini S2-2 R Rashad, Aljijakli S2-1 S  ... 
doi:10.1109/istt50966.2020.9279344 fatcat:scimmsad6ng7tnmjnygyhyfybu

Replacing Mosfets With Single Electron Transistors (Set) To Reduce Power Consumption Of An Inverter Circuit

Ahmed Shariful Alam, Abu Hena M. Mustafa Kamal, M. Abdul Rahman, M. Nasmus Sakib Khan Shabbir, Atiqul Islam
2016 Zenodo  
Abdul Rahman, M.  ...  When NMOS is in cut off region ( GS tn V V  ), 0 D I  (1) When NMOS is in resistive region ( GS tn V V  and DS G S t n V V V   ),   2 2 n n D S D G S t n D S n W V I V V V D L           ... 
doi:10.5281/zenodo.1126153 fatcat:jbt7j6tqkzfz7np7cj3z6s2kne

Page 164 of National Union Catalog Vol. 29, Issue [page]

1963 National Union Catalog  
TA640.6.K45 531.25 67-496 NBuU CoU Khan, S A Siddiq, joint author see Aziz, A. F, M, Abdul, 1907- fay Mm jadd A. Alph hant 1961- Khan, S M The finest Indian Muslim cooking, by S. N. M. Khan.  ...  PK1718.K54D8 S A 64-7841 PL 480: EP-B-06 Khan, Shabbir Hasan see Josh Malihabadi, Shabbir Hasan Khan. Khan, Shah Wali see Shah Wali Khan, 1881- 164 Khan, Shahid ‘Alt. 11963 *Weo pol!  ... 

Page 490 of National Union Catalog Vol. 24, Issue [page]

1958 National Union Catalog  
Calcutta, Iran At head of the titie: Abdul Halim memorial volume. 1. Kashmir~-Hist.  ...  European Military mission. ebay Bahadur s Shah vu. 1858, Ram, M Ix, Title. 59-39022  ... 

A Study of Encryption Algorithms (RSA, DES, 3DES and AES) for Information Security

Gurpreet Singh, Supriya Supriya
2013 International Journal of Computer Applications  
-Diaa Salama Abdul.  ...  Shabbir and Y. Al-Nabhani, "New Comparative Study Between DES, 3DES and AES within Nine Factors", Journal Of Computing, Volume 2, ISSUE 3, pp. 152-157, MARCH 2010.  ... 
doi:10.5120/11507-7224 fatcat:ubssrj6znbhchkdhpxw2llumwa
« Previous Showing results 1 — 15 out of 346 results