Filters








11,412 Hits in 1.8 sec

The Effect of Dietary Fiber on Metabolic Syndrome and Adiponectin

Ki Jong Lee, Ji Hyun Suh, Young Ahn, Sung Hae Ha, Ju Sang Park, Eun Jeong Jang, Sang Jong Park, Sang Jung Kim, Sang Woon Park, Hyun Wook Baik
2011 Journal of Clinical Nutrition  
Purpose: In Korea, the prevalence of metabolic syndrome has increased. The relationship between metabolic syndrome, adiponectin, and dietary components is widely known. However, the relation between cytokine and dietary components is not yet well studied in Korea. Methods: Five hundred and ninety-six Korean adults between 30 and 59 years of age were recruited by advertisement to the Bundang Jesaeng General Hospital (BJ-GH), and those not taking regular medications and without diagnoses of
more » ... ant disease were included. Data was collected on anthropometric measurements, diagnostic parameters for metabolic syndrome (MetS), and 3-day dietary intakes from individuals in the study. Results: Serum adiponectin level was positively correlated with serum HDL-cholesterol level and was negatively correlated with BMI, waist circumference, and systolic and diastolic blood pressure. Intake of dietary fiber was high in the high-adiponectin group. Conclusion: High-fiber diet and adiponectin can be helpful for improving metabolic syndrome. (JKSPEN 2011; 4(1):16-20)
doi:10.15747/jcn.2011.4.1.16 fatcat:n7o3fhscsnewrjmq4sf7yex5em

Graphene plasmon-phonon coupled modes at the exceptional point [article]

Sang Hyun Park, Shengxuan Xia, Sang-Hyun Oh, Phaedon Avouris, Tony Low
2020 arXiv   pre-print
Properties of graphene plasmons are greatly affected by their coupling to phonons. While such coupling has been routinely observed in both near-field and far-field graphene spectroscopy, the interplay between coupling strength and mode losses, and its exceptional point physics has not been discussed. By applying a non-Hermitian framework, we identify the transition point between strong and weak coupling as the exceptional point. Enhanced sensitivity to perturbations near the exceptional point
more » ... observed by varying the coupling strength and through gate modulation of the graphene Fermi level. Finally, we also show that the transition from strong to weak coupling is observable by changing the incident angle of radiation.
arXiv:2012.03875v1 fatcat:zxppd4x3a5g7li45yjvuzxw73a

Classification of Distal Fingertip Amputation Based on the Arterial System for Replantation

Hyun Park, Ahmed Bahar-Moni, Sang Cho, Sang Kim, Hyun Park, Sang Ahn
2016 Journal of hand and microsurgery  
During replantation of distal fingertip amputation
doi:10.1007/s12593-012-0086-7 pmid:24426662 pmcid:PMC3650162 fatcat:a6nvwnmdnnc7vfqsgiqf3dx4yi

AdS from Entanglement Entropy [article]

Seungjoon Hyun, Sang-A Park
2017 arXiv   pre-print
ACKNOWLEDGMENTS We would like to thank Jae-Suk Park and Kyung Kiu Kim for useful discussion. SH would like to thank KEK and KIAS for hospitality, where part of this work has been done.  ... 
arXiv:1709.07395v1 fatcat:afibht64nbfzlafyft5m57jldi

The Adequacy of an Enteral Formula Feeding to Maintain Nutritional Status

Kyoung Hwa Yoo, In Myung Oh, Ji Eun Park, Ju Sang Park, Eun Jeong Jang, Sang Jong Park, Sang Jung Kim, Sang Woon Park, Hyun Wook Baik
2013 Journal of Clinical Nutrition  
Purpose: It is a well-established fact that enteral nutrition is the preferred mode when compared with parenteral nutrition for the purpose of recovery and maintaining nutritional status not only in surgical but also in chronic debilitating patients. Further, this mode of nutrition is essential as it enhances preservation of gut mucosal integrity as well as immunity particularly in such patients. In a prospective multicenter clinical trial, we studied the effectiveness and safety of one
more » ... enteral formula 'M'. Methods: We recruited 30 patients who were admitted to three hospitals (two university hospitals and one general hospital) in a metropolitan area for either surgery or treatment. The patients were given the enteral formula M at the dose of 25 kcal/kg/day for 7±2 days. Thereafter, we evaluated the performance and nutritional status of each patient by applying subjective global assessment (SGA) scale, Karnofsky performance status scale, and stroke specific quality of life (SS-QOL) scale. We also measured the plasma markers specific to nutritional status of such patients. In addition, we also recorded the consequent dose-response clinical symptoms such as diarrhea, abdominal pain, abdominal discomfort, bloating, nausea, and vomiting. Results: We found that the SGA scale score did not show significant change compared to the baseline score. However, both the Karnofsky performance status score and the SS-QOL score showed the tendency of improvement compared to the baseline score. We also found that there was a decrease in the serum markers used to signify the nutritional status of the patients, but this decrease was statistically not significant when compared to the baseline score. Of the 30 patients enrolled for this study, 12 patients showed distinct clinical adverse symptoms. The most commonly observed adverse response was abdominal pain, although all other symptoms subsided spontaneously. Conclusion: We conclude that the administration of enteral formula 'M' to both perioperative and chronic debilitating patients hardly elicited serious adverse response. In fact, the formula was significant in preserving the performance status and quality of life of both perioperative and chronic debilitating patients. (JKSPEN 2013;5(2):76-81) 서 론 뇌졸중, 치매, 파킨슨병 등 노인성 질환의 증가와 더불어 연하 기능에 장애를 보이는 환자가 증가하고 있으며, 1 이러 한 환자들은 흡인의 위험이 있어 구강으로 영양을 섭취하 는 데 어려움이 따른다. 2,3 또한 수술 후 회복기의 환자들의 경우, 식욕 부진으로 충분한 식사를 하지 못하여 회복이 지 연되는 경우가 있는데, 이러한 경우 불충분한 영양 섭취로 인하여 면역력이 저하되어 감염에 취약해질 뿐만 아니라 환자의 기저 질환도 악화될 수 있으므로 적절한 영양 공급 은 환자의 치료에 있어 간과해서는 안될 중요한 요소이다. 4 소화관의 기능이 정상인 경우, 장 점막 흡수력 및 면역력 유지, 담도계 합병증 예방과 경제적 효율성 등의 이유로 경 장 영양(enteral nutrition)을 더 권장하고 있다. 5-9 본 연구에서 는 수술 전후 대상자와 만성 질환자 중 경구 섭취가 불가능 한 환자들을 대상으로 경장 영양액 M을 투여하여, 환자 영
doi:10.15747/jcn.2013.5.2.76 fatcat:cku6tpsqp5aythhzco25xg7dgm

Commentary on "Impact of age on outcomes of midurethral sling procedures in women", So Hyun Ahn, Yun Jin Park, Mi Kyung Kong, Sang Wook Bai, International Urogynecology Journal, 2019

Marianne Koch
2019 International Urogynecology Journal  
Ahn SH, Park YJ, Kong MK, et al. Impact of age on outcomes of midurethral sling procedures in women. Int Urogynecol J. 2019; https://doi.  ... 
doi:10.1007/s00192-019-04133-2 pmid:31813029 fatcat:y2hu42xjwnfhpmkfz5yqcls6rm

Genetic diversity of porcine sapoviruses

Cheol Jeong, Sang-Ik Park, Sung-Hee Park, Ha-Hyun Kim, Su-Jin Park, Jae-Ho Jeong, Hyon E. Choy, Linda J. Saif, Sang-Ki Kim, Mun-Il Kang, Bang-Hun Hyun, Kyoung-Oh Cho
2007 Veterinary Microbiology  
., 2001; Park et al., 2006) .  ...  ., 2001; Park et al., 2006) . The amplification products were analyzed by 1.5 or 2% agarose gel electrophoresis and visualized by UV after ethidium bromide staining.  ... 
doi:10.1016/j.vetmic.2007.02.008 pmid:17382492 pmcid:PMC7117395 fatcat:bkbxkjioqza7hohhs2uxba2sc4

Molecular epidemiology of bovine noroviruses in South Korea

Sang-Ik Park, Cheol Jeong, Ha-Hyun Kim, Sung-Hee Park, Su-Jin Park, Bang-Hun Hyun, Dong-Kun Yang, Sang-Ki Kim, Mun-Il Kang, Kyoung-Oh Cho
2007 Veterinary Microbiology  
., 2001; Park et al., 2006) .  ...  ) nR: TTGCCACCATTTTTTCCAAT BRV B VP7 F: GGAAATAATCAGAGATG 1-795 795 42 Barman et al. (2004) R: CTACTCGTTTGGCTCCCTCC BRV C VP6 F: TCAAGAAATGGWATGCAACC 334-918 585 50 Park et al. (2006)  ... 
doi:10.1016/j.vetmic.2007.03.010 pmid:17466472 pmcid:PMC7117243 fatcat:yuxeu45qlvhrppdfwlrfki7vwy

A Microsurgical Suture Technique Without the Need for Vascular Clamps

Hyun Park, Ahmed Bahar Moni, Jin Chang, Sang Cho, Hyun Park, Sang Ahn
2016 Journal of hand and microsurgery  
Vascular clamps are often used during microvascular repair and anastomosis. However, pressure exerted by the clamps may damage the vessels, which compromises patency of vessels. This article reports on a microsurgical suture technique performed without any clamp to avoid clamp-related problems.
doi:10.1007/s12593-014-0126-6 pmid:25414561 pmcid:PMC4235818 fatcat:lpilb7o7vzb5bcoporehjbohya

An Electromagnetic Compressive Force by Cell Exciter Stimulates Chondrogenic Differentiation of Bone Marrow?Derived Mesenchymal Stem Cells

Sang-Hyug Park, Woo Young Sim, Sin Wook Park, Sang Sik Yang, Byung Hyune Choi, So Ra Park, Kwideok Park, Byoung-Hyun Min
2006 Tissue engineering  
Color images available online at www.liebertpub.com/ten. 3112 PARK ET AL. FIG. 4 .FIG. 5 . 45 Immunohistochemistry for type II collagen.  ...  Sense 5 0 -agctttacaacaaatacccagatg-3 0 55 Antisense 5 0 -taggagattctgcttctgagatg-3 0 ALP: alkaline phosphatase, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, PCR: polymerase chain reaction. 3110 PARK  ... 
doi:10.1089/ten.2006.12.ft-262 fatcat:yokfstqijfg2tfc7a7akedogty

An Electromagnetic Compressive Force by Cell Exciter Stimulates Chondrogenic Differentiation of Bone Marrow–Derived Mesenchymal Stem Cells

Sang-Hyug Park, Woo Young Sim, Sin Wook Park, Sang Sik Yang, Byung Hyune Choi, So Ra Park, Kwideok Park, Byoung-Hyun Min
2006 Tissue engineering  
Color images available online at www.liebertpub.com/ten. 3112 PARK ET AL. FIG. 4 .FIG. 5 . 45 Immunohistochemistry for type II collagen.  ...  Sense 5 0 -agctttacaacaaatacccagatg-3 0 55 Antisense 5 0 -taggagattctgcttctgagatg-3 0 ALP: alkaline phosphatase, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, PCR: polymerase chain reaction. 3110 PARK  ... 
doi:10.1089/ten.2006.12.3107 pmid:17518626 fatcat:bhbuu6koonbsnirbqestasqta4

Telomerase expression in colorectal tubular adenoma determined by immunohistochemical staining

Ho Dong Kim, Young Sang Oh, Soo Hyun Kim, Sang Pil Kim, Hyun Hak Shin, Ju Yong Park, Hyeuk Park, Bo Hyun Myoung, Do Hyun Kim, Young Jik Lee, Hyung Rag Kim, Young Do Jung
2007 Korean Journal of Gastroenterology  
Telomeres are simple repeat elements located at each chromosome end of eukaryotic cells. The main function of telomeres is to cap the chromosome end and protect it from enzymatic attack. Telomerase that facilitates the synthesis of telomere has been detected in not only cancer but also precancerous lesion. In this study, we compared the telomerase expression between low grade and high grade colorectal tubular adenoma. Among tissues from forty eight patients with colorectal tubular adenoma (23
more » ... w grade and 25 high grade colorectal dysplasia), telomerase expressions were evaluated by immunohistochemical staining. We classified 48 patients into two groups by the extent of nuclei staining pattern. High telomerase expression was a group which showed staining nucleus pattern above 50% in tubular adenoma. Low telomerase expression was a group which showed staining pattern nucleus below 50%. Twelve in 25 high grade colorectal dysplasia showed high telomerase expression (48%). Only one in 23 low grade colorectal dysplasia showed high telomerase expression (4%). Telomerase expression was much higher in the tissues from the patients with high grade than in those with low grade colorectal dysplasia (p<0.05). Activation of telomerase may be related to the malignant potential in colorectal epithelial cells. Further studies are needed to define the role of telomerase in colorectal tumorigenesis.
pmid:17885281 fatcat:gnslzsklhzfghgi2ojz63zmzf4

Effect of Intravenous High-Dose Selenium Supplementation in Patients with Systemic Inflammatory Response Syndrome: A Pilot Study

Mi-Jeoung Kim, Ki-Jong Lee, In-Myung Oh, Dong-Hyun Oh, Kyoung-Hwa Yoo, Ju-Sang Park, Eun-Jeong Jang, Sang-Jong Park, Sang-Woon Park, Sang-Jung Kim, Hyun Wook Baik
2013 Korean Journal of Medicine  
Background/Aims: Systemic inflammatory response syndrome (SIRS) can induce occurrence of oxidative stress. Several reports have evaluated selenium supplementation in SIRS patients with encouraging results. Therefore, we evaluated the effect of intravenous high-dose selenium supplementation in patients with SIRS. Methods: Patients were randomly assigned to one of two groups: the selenium group (800 µg/day of selenoic acid by intravenous bolus injection for 7 days) or the placebo group. Physical
more » ... nd biochemical measurements were used to assay acute phase reactants, severity of illness index and serum selenium concentration. Results: A total of 23 patients classified as mild-to-moderate severity of illness index were enrolled between March 2010 and October 2011. Serum selenium concentration increased in the selenium group after intervention, but there was no significant change in the placebo group. In the selenium group, the white blood cell (WBC) count, serum level of c-reactive protein (CRP), Acute Physiology and Chronic Health Evaluation II (APACHEII) score and Sequential Organ Failure Assessment (SOFA) score improved significantly by days 7 and 14 compared with day 0. In the placebo group, only the serum CRP level at day 14 and APACHE II score at days 7 and 14 improved significantly compared to day 0. Conclusions: Intravenous supplementation with high-dose selenium improved acute phase reactants and the severity of illness index in patients with SIRS. However, larger prospective clinical trials are required to determine the efficacy of selenium supplementation in SIRS patients. (Korean J Med 2013;84:531-540)
doi:10.3904/kjm.2013.84.4.531 fatcat:c73acayyuvdxhoebvy7h2w3vdq

Beyond Volume

Jae-Hyun Kim, Eun-Cheol Park, Sang Gyu Lee, Tae-Hyun Kim, Sung-In Jang
2016 Medicine  
We examined whether the level of hospital-based healthcare technology was related to the 30-day postoperative mortality rates, after adjusting for hospital volume, of ischemic stroke patients who underwent a cerebrovascular surgical procedure. Using the National Health Insurance Service-Cohort Sample Database, we reviewed records from 2002 to 2013 for data on patients with ischemic stroke who underwent cerebrovascular surgical procedures. Statistical analysis was performed using Cox
more » ... hazard models to test our hypothesis. A total of 798 subjects were included in our study. After adjusting for hospital volume of cerebrovascular surgical procedures as well as all for other potential confounders, the hazard ratio (HR) of 30-day mortality in low healthcare technology hospitals as compared to high healthcare technology hospitals was 2.583 (P < 0.001). We also found that, although the HR of 30-day mortality in low healthcare technology hospitals with high volume as compared to high healthcare technology hospitals with high volume was the highest (10.014, P < 0.0001), cerebrovascular surgical procedure patients treated in low healthcare technology hospitals had the highest 30-day mortality rate, irrespective of hospital volume. Although results of our study provide scientific evidence for a hospital volume/30-day mortality rate relationship in ischemic stroke patients who underwent cerebrovascular surgical procedures, our results also suggest that the level of hospital-based healthcare technology is associated with mortality rates independent of hospital volume. Given these results, further research into what components of hospital-based healthcare technology significantly impact mortality is warranted. (Medicine 95(11):e3035) Abbreviations: HR = Hazard Ratio, ICD-10 = International Classification of Diseases, 10th Revision, IRB = Institutional Review Board, MRIm = agnetic resonance imaging, NHIS-CSD = National Health Insurance Service-Cohort Sample Data, PCCLp = atient clinical complexity level. ISSN: 0025-7974 FIGURE 3. Combined variable analysis between hospital-based healthcare technology and hospital volume of cerebrovascular surgery and 30-d, all-cause mortality. FIGURE 2. Hospital volume of cerebrovascular surgery and 30-d, all-cause mortality. HR ¼ hazard ratio, MRI ¼ magnetic resonance imaging, PCCL ¼ patient clinical complexity level, SE ¼ standard error. Ã Operation of cerebral arteriovenous malformation, operation of skull base, carotid artery ligation, and endoscopic brain surgery. FIGURE 4. Adjusted association between hospital-based healthcare technology and all-cause mortality (Model 3).
doi:10.1097/md.0000000000003035 pmid:26986122 pmcid:PMC4839903 fatcat:bubyj7mwpvgfbbogmfh4lw4v3e

Intraventricular Vancomycin Therapy for Intractable Bacillus cereus Ventriculitis

Jong Woo Hahn, Hee young Ju, Meerim Park, Eun Sang Yi, Byung-Kiu Park, Sang-Hoon Shin, Sang-Hyun Lee, Hyeon Jin Park, Ji-Man Kang
2019 Pediatric Infection & Vaccine  
Bacillus cereus causes serious central nervous system infections, especially in immunocompromised patients. Successful treatment requires adequate antimicrobial concentrations in the cerebrospinal fluid; however, in some cases, achieving this with systemic treatment alone is difficult. We treated intractable B. cereus ventriculitis with intraventricular vancomycin, with no major adverse events.
doi:10.14776/piv.2019.26.e15 fatcat:sz4jqtqb25f7hmvmwrpyxoiggu
« Previous Showing results 1 — 15 out of 11,412 results