Filters








1,644 Hits in 0.95 sec

Polyether-Based Supramolecular Electrolytes With Two-Dimensional Boroxine Skeleton

Masahiro Yoshizawa-Fujita, Shunsuke Horiuchi, Tamao Uemiya, Jun Ishii, Yuko Takeoka, Masahiro Rikukawa
2021 Frontiers in Energy Research  
Solid polymer electrolytes mainly based on polyethers have been actively investigated for over 40 years to develop safe, light, and flexible rechargeable batteries. Here, we report novel supramolecular electrolytes (SMEs) composed of polyether derivatives and a two-dimensional boroxine skeleton synthesized by the dehydration condensation of 1,4-benzenediboronic acid in the presence of a polyether with amines on both chain ends. The formation of SMEs based on polyether derivatives and boroxine
more » ... ives and boroxine skeleton was confirmed by Fourier transform infrared (FT-IR) spectroscopy, X-ray photoelectron spectroscopy (XPS), powder X-ray diffraction (PXRD), and thermogravimetric (TG) analysis. Linear sweep voltammetry (LSV) and cyclic voltammetry (CV) were performed to evaluate the electrochemical stability and lithium conductive properties of SMEs with given amounts of lithium bis(trifluoromethylsulfonyl)amide (LiTFSA). The ionic conductivity of SME/LiTFSA composites increased with increasing lithium-salt concentration and reached a maximum value at a higher concentration than those of simple polyether systems. The lithium-ion transference number (tLi+) of SME/LiTFSA was higher than those of polyether electrolytes. This tendency is unusual for a polyether matrix. SME/LiTFSA composite electrolytes exhibited a stable lithium plating/striping process even after 100 cycles. The current density increased with an increasing number of cycles. The combination of ion conductive polymers and a two-dimensional boroxine skeleton will be an interesting concept for developing solid electrolytes with good electrochemical properties.
doi:10.3389/fenrg.2021.663270 fatcat:krio6liwencqbhe5dn564eovzi

Oligoether/Zwitterion Diblock Copolymers: Synthesis and Application as Cathode-Coating Material for Li Batteries

Masahiro Yoshizawa-Fujita, Jun Ishii, Yuko Takeoka, Masahiro Rikukawa
2021 Polymers  
Poly (ethylene oxide) (PEO) has been investigated as an ion-conductive matrix for several decades due to its excellent properties. However, further improvements are needed to enable a PEO-based ion-conductive matrix for practical applications. In order to develop novel solid polymer electrolytes based on zwitterions, we synthesized diblock copolymers (PPEGMA-b-SPBs) with oligoether and zwitterionic side-chains and evaluated their physico-chemical properties. PPEGMA-b-SPBs with various unit
more » ... h various unit ratios were synthesized by RAFT polymerization. PPEGMA-b-SPBs with/without LiTFSA exhibited two distinct glass transition temperatures regardless of the unit ratio of PEGMA and SPB. AFM observations clearly revealed phase-separated structures. The ionic conductivity of PPEGMA-b-SPBs increased even at a high salt concentrations such as [EO]:[Li] = 6:1 and was over 10-5 S cm-1 at 25 °C. This tendency is unusual in a PEO matrix. The oxidation stability of PPEGMA-b-SPBs was about 5.0 V vs. Li/Li+, which is a higher value than that of PEO. The improvement of the electrochemical properties is attributed to the introduction of the SPB block into the block copolymers. PPEGMA-b-SPBs were evaluated as cathode-coating materials for Li batteries. The discharge capacity and coulombic efficiency of the cells employing the cathode (LiNi1/3Mn1/3Co1/3O2 (NMC)) coated with the block copolymers were much higher than those of the cell employing the pristine cathode at the 50th cycle in the cut-off voltage range of 3.0-4.6 V.
doi:10.3390/polym13050800 pmid:33807821 pmcid:PMC7961851 fatcat:dsynnkzef5c7nb6v6a633j644m

Online Model Selection And Learning By Multikernel Adaptive Filtering

Ryu-ichiro Ishii, Masahiro Yukawa
2013 Zenodo  
Publication in the conference proceedings of EUSIPCO, Marrakech, Morocco, 2013
doi:10.5281/zenodo.43453 fatcat:frbnmuwglrbtxgzno3dhune3si

3D flash lag illusion

Masahiro Ishii, Himali Seekkuarachchi, Hiroki Tamura, Zheng Tang
2004 Vision Research  
Objective of this research is to study the presence of 3D flash lag illusion created by a moving object that has a motion-in-depth and a flash object. An object consisting of two thin sticks was simulated to approach the subject who observed it with a stereoscope. In the process of approaching, another stick was briefly presented in the middle of the moving sticks. Five human subjects took part in our experiments and all perceived 3D flash lag illusion. The perceived depth created by 3D flash
more » ... eated by 3D flash lag illusion was measured by two different psychophysical experiments, by use of a vernier caliper and by a method of nulling with another depth cue. We studied relation between the perceived depth and the presentation distance. The experimental results indicate that the perceived gap by 3D flash lag illusion is independent from the presentation distance.
doi:10.1016/j.visres.2004.03.026 pmid:15149831 fatcat:5vlqhssbhvc33grerdu7cpksjq

Optical Rheology of Porcine Sclera by Birefringence Imaging

Masahiro Yamanari, Kotaro Ishii, Shinichi Fukuda, Yiheng Lim, Lian Duan, Shuichi Makita, Masahiro Miura, Tetsuro Oshika, Yoshiaki Yasuno, Pedro Gonzalez
2012 PLoS ONE  
To investigate a relationship between birefringence and elasticity of porcine sclera ex vivo using polarization-sensitive optical coherence tomography (PS-OCT). Elastic parameters and birefringence of 19 porcine eyes were measured. Four pieces of scleral strips which were parallel to the limbus, with a width of 4 mm, were dissected from the optic nerve head to the temporal side of each porcine eye. Birefringence of the sclera was measured with a prototype PS-OCT. The strain and force were
more » ... nd force were measured with a uniaxial material tester as the sample was stretched with a speed of 1.8 mm/min after preconditioning. A derivative of the exponentially-fitted stress-strain curve at 0% strain was extracted as the tangent modulus. Power of exponential stress-strain function was also extracted from the fitting. To consider a net stiffness of sclera, structural stiffness was calculated as a product of tangent modulus and thickness. Correlations between birefringence and these elastic parameters were examined. Statistically significant correlations between birefringence and all of the elastic parameters were found at 2 central positions. Structural stiffness and power of exponential stress-strain function were correlated with birefringence at the position near the optic nerve head. No correlation was found at the position near the equator. The evidence of correlations between birefringence and elasticity of sclera tested uniaxially was shown for the first time. This work may become a basis for in vivo measurement of scleral biomechanics using PS-OCT.
doi:10.1371/journal.pone.0044026 pmid:22970158 pmcid:PMC3435379 fatcat:gp5z3uw32fgihcakkdmnzcj4l4

Universal acquired melanosis: carbon baby

Shiro Niiyama, Yuki Bando, Masahiro Ishii, Kensei Katsuoka
2013 Dermatology Online Journal  
We report a 3-year-old boy born with light brown skin that progressively became much darker. The color change was insidious in onset at the age of 3 months, asymptomatic, and progressive involving the entire body surface. Hyperpigmentation may be congenital or acquired, hereditary or nonhereditary, localized or universal, of known or unknown origin. Universal acquired melanosis is a rare form of hyperpigmentation, which has been synonymously referred to as "carbon baby."
doi:10.5070/d3197018961 fatcat:mqavwbajirgz5cvuf7ax5bkxri

A Solitary Bronchial Papilloma with Malignant Changes

Yuichi INOUE, Mikio OKA, Hiroshi ISHII, Koji KIMINO, Masao KISHIKAWA, Masahiro ITO, Tetsuya ITO, Masahiro NAKASHIMA, Shigeru KOHNO
2001 Internal medicine (Tokyo. 1992)  
Wedescribe a case of solitary papilloma of the bronchus and provide a review of 38 similar cases reported in Japan. A 70-year-old man complained of cough and sputum. Chest X-rays and CT scans revealed atelectasis of the right middle lobe. On bronchoscopy, a polypoid tumor was found at the orifice of the bronchus of the right middle lobe. The tumor was histologically diagnosed as a squamous papilloma with moderateatypia. Becauseof elevated tumormarkers and the reported high incidence of
more » ... cidence of malignant changes in papillomas, the tumor was endoscopically resected by electrosurgical snare. While this procedure resulted in improvement of atelectasis, the chest CT taken subsequently revealed a mass adjacent to the resected polypoid tumor in the middle lobe bronchus. Percutaneous needle biopsy followed by histopathological examination confirmed the tumor to be a squamous cell carcinoma. Only three cases of malignant changes in papillomas have been previously reported in Japan. Electrosurgical snare, which allows the identification of tissue at the tumor base, should be the treatment of choice rather than YAGlaser surgery. (Internal Medicine 40: 56-60, 2001)
doi:10.2169/internalmedicine.40.56 fatcat:ukhxqms7mnhvdcd4jwtf7c46qq

Glucose-incretin interaction revisited [Review]

Hiroaki Ishii, Yoshihiko Sato, Masahiro Takei, Shinichi Nishio, Mitsuhisa Komatsu
2011 Endocrine journal  
Pancreatic beta cell dysfunction is pivotal to the development of diabetes, and restoration of insulin action is of primary importance. Here, we present a review of the mechanism of insulin secretion by pancreatic beta cells and discuss the mutual interaction of signaling pathways in stimulus-secretion coupling to better understand the scientific basis of pharmacological treatment for insulin secretion deficiency. Glucose stimulates insulin secretion via membrane depolarization by closure of
more » ... on by closure of ATP-sensitive K + channels (K ATP channels) and opening of L-type voltage-dependent Ca 2+ channels. The resultant elevation of cytosolic free Ca 2+ triggers insulin exocytosis. This is termed the "K ATP -dependent pathway" and is shared by sulfonylurea, which closes K ATP channels. Glucose also stimulates insulin release independent of its action on K ATP channels. This is referred to as the "K ATP -independent pathway," the molecular basis of which remains elusive. In the pancreatic beta cell, incretin hormones increase cAMP level, which enhances glucose-stimulated insulin release by protein kinase A-dependent and -independent mechanisms. Importantly, cAMP does not directly augment Ca 2+ -stimulated insulin release per se. The stimulatory level of ambient glucose is an absolute requirement for incretin to enhance insulin release. Therefore, incretin/cAMP enhances K ATP -independent insulinotropic action of glucose. The robust glucoselowering effect of DPP4 inhibitor add-on in diabetic patients with sulfonylurea secondary failure is intriguing. With the clinical availability of DPP4 inhibitor and GLP-1 mimetics, the importance of the interactions between cAMP signaling and K ATP channel-independent actions of glucose is reappraised.
doi:10.1507/endocrj.ej11-0064 pmid:21701075 fatcat:pbx7eliyv5hzdfwazdp3jzuolu

An Efficient Kernel Adaptive Filtering Algorithm Using Hyperplane Projection Along Affine Subspace

Ryu-ichiro Ishii, Masahiro Yukawa
2012 Zenodo  
Publication in the conference proceedings of EUSIPCO, Bucharest, Romania, 2012
doi:10.5281/zenodo.52430 fatcat:ate3tmxy5raj3nqbvmoukefm74

Preoperative C-reactive protein as a prognostic factor in stage IV colorectal cancer

Hiroka Kondo, Yasumitsu Hirano, Toshimasa Ishii, Shintaro Ishikawa, Takatsugu Fujii, Masahiro Asari, Atsuko Kataoka, Masahiro Kataoka, Satoshi Shimamura, Shigeki Yamaguchi
2021 International surgery  
A prognosis for stage IV colorectal cancer is generally poor. As a result, the development of an appropriate treatment strategy for each individual with this disease within a limited time frame is important. Few studies have been made of CRP in stage IV cases of colorectal cancer so it is unclear whether CRP is a useful prognostic marker for this disease. Thus, the purpose of this study was to clarify the relationship between the preoperative CRP level and the prognosis of stage IV colorectal
more » ... age IV colorectal cancer. Patients and methods Between April 2007 and December 2015, 384 patients with stage IV colorectal cancer who underwent primary resection were included. Patients were divided into high (HCG) and low (LCG) CRP groups based on a preoperative CRP cut-off value of ≥1.0 mg/dL. Postoperative short- and long-term results were examined retrospectively. Results The 5-year survival rate was 24.6% for HCG and 36.7% for LCG, indicating the survival rate for HCG was lower. The study was limited to patients who were unable to undergo R0 surgery. Preoperative CEA levels were higher in HCG while the postoperative chemotherapy induction rate was lower. HCG also showed a significantly lower survival rate than LCG. Multivariate analysis showed that CRP levels above 1.0 mg/dL, poorly differentiated histopathology, and the absence of chemotherapy were risk factors affecting overall survival. Conclusion These results suggest that the preoperative CRP level may be a useful biomarker for the prognosis of incurable stage IV colorectal cancer.
doi:10.9738/intsurg-d-20-00035.1 fatcat:5yfbdwk5jne27lds67teyiwj5m

Inconsistent diversities between nuclear and plastid genomes of AA genome species in the genus Oryza

Hao Yin, Masahiro Akimoto, Reunreudee Kaewcheenchai, Masahiro Sotowa, Takashige Ishii, Ryuji Ishikawa
2015 Genes & Genetic Systems  
(T)17 Ishii and McCouch. (2000) RCt9 ATAAGGTTATTCCCCGCTTACC AAATTGGGGGAATTCGTACC (T)10 Ishii and McCouch. (2000) RCt10 TCTTCATTTGGAATCTGGGC CTATTGATGCAAACGCTGTAC C (T)10 Ishii and McCouch  ...  Molecular markers Chloroplast single-nucleotide repeat markers, RCt1-RCt10, were applied to evaluate the genetic diversity of the maternal origins of AA genome species (Ishii and McCouch, 2000; Ishii  ... 
doi:10.1266/ggs.14-00063 pmid:26687860 fatcat:rrigcjolnnbm5ph67u7ks4iauy

Experiences with rhinomicrosurgery
顕微鏡下鼻内手術の経験

Masahiro Takahashi, Mitsuko Itoh, Juuko Ishii
1988 Practica Oto-Rhino-Laryngologica  
Surgical methods (instruments and techniques), surgical anatomy and indications for rhino-microsurgery are described. A self retaining retractor speculum facilitates bimanual operation under a microscope. Microsurgery proved to be very useful for attaining magnification, safety and selective surgery as well as avoiding extranasal operations. The relationship between the viewing axis of the microscope and the patient's head is important to determine the fields of operation. As landmarks for
more » ... landmarks for opening the sinuses, we used the anterior wall of the sphenoid sinus, the funnel of the orbit and the posterior end of the middle turbinate. The microscopic intranasal operation, being safe and cosmetically excellent, is appropriate for treating the most posterior part of the sinuses.
doi:10.5631/jibirin.81.1295 fatcat:qjh2gwx26bc47psxwhafyg3sca

Studies on the Flavor of Meats

Mamoru TERASAKI, Masahiro KAJIKAWA, Eiichiro FUJITA, Kiyofumi ISHII
1965 Agricultural and Biological Chemistry  
Considerable amounts of inosine and hypo xanthine were detected besides IMP in those Mamoru TERASAKI, Masahiro KAJIKAWA, Eiichiro FUJITA and Kiyofumi ISHII FIG. 7.  ...  KAJIKAWA, Eiichiro FUJITA and Kiyofumi ISHII FIG. 2. Separation of Nucleotides from Chicken Meat.  ... 
doi:10.1271/bbb1961.29.208 fatcat:nc4o5nnhevh45gxd5plg72q55u

Standardization of a Cold Caloric Test

Tetsuo ISHII, Naomi TSUJITA, Masahiro TAKAHASHI, Ikuyo AKIYAMA
1986 Practica Oto-Rhino-Laryngologica  
doi:10.5631/jibirin.79.supplement2_68 fatcat:r6buisl425dbzaqzwjshk66mwu

Glucose-stimulated insulin secretion: A newer perspective

Mitsuhisa Komatsu, Masahiro Takei, Hiroaki Ishii, Yoshihiko Sato
2013 Journal of Diabetes Investigation  
Existing concepts and models for glucose-stimulated insulin secretion (GSIS) are overviewed and a newer perspective has been formulated toward the physiological understanding of GSIS. A conventional model has been created on the basis of in vitro data on application of a square wave high glucose in the absence of any other stimulatory inputs. Glucose elicits rapid insulin release through an adenosine triphosphate-sensitive K + channel (K ATP channel)-dependent mechanism, which is gradually
more » ... h is gradually augmented in a K ATP channel-independent manner. Biphasic GSIS thus occurs. In the body, the b-cells are constantly exposed to stimulatory signals, such as glucagon-like peptide 1 (GLP-1), parasympathetic inputs, free fatty acid (FFA), amino acids and slightly suprathreshold levels of glucose, even at fasting. GLP-1 increases cellular cyclic adenosine monophosphate, parasympathetic stimulation activates protein kinase C, and FFA, amino acids and glucose generate metabolic amplification factors. Plasma glucose concentration gradually rises postprandially under such tonic stimulation. We hypothesize that these stimulatory inputs together make the b-cells responsive to glucose independently from its action on K ATP channels. Robust GSIS in patients with a loss of function mutation of the sulfonylurea receptor, a subunit of K ATP channels, is compatible with this hypothesis. Furthermore, pre-exposure of the islets to an activator of protein kinase A and/or C makes b-cells responsive to glucose in a K ATP channel-and Ca 2+ -independent manner. We hypothesize that GSIS occurs in islet b-cells without glucose regulation of K ATP channels in vivo, for which priming with cyclic adenosine monophosphate, protein kinase C and non-glucose nutrients are required. To understand the physiology of GSIS, comprehensive integration of accumulated knowledge is required. (J Diabetes Invest,
doi:10.1111/jdi.12094 pmid:24843702 pmcid:PMC4020243 fatcat:lrpkaohyjbepjbiabve4auc4by
« Previous Showing results 1 — 15 out of 1,644 results