Filters








1 Hit in 3.6 sec

Leptospira interrogans Outer Membrane Protein-Based Nanohybrid Sensor for the Diagnosis of Leptospirosis

Vivek Verma, Deepak Kala, Shagun Gupta, Harsh Kumar, Ankur Kaushal, Kamil Kuča, Natália Cruz-Martins, Dinesh Kumar
2021 Sensors  
The promising results obtained suggest the application of the developed sensor as a point of care device for the diagnosis of leptospirosis.  ...  This DNA-based sensor only takes 30 min for rapid detection of the pathogen, with a higher specificity and sensitivity.  ...  MBMM 5 TGAGTTATACTTGGGTGGTC3 cDNA: Table 2 . 2 Comparison of the different types of biosensors developed for the detection of leptospirosis with the present method based on the Loa22 gene of Leptospira  ... 
doi:10.3390/s21072552 pmid:33917354 fatcat:dxwzbg3hf5bwpe35jb56rq7y4e