A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2021; you can also visit the original URL.
The file type is application/pdf.
Filters
Cloning and Functional characterization of seed-specific LEC1A promoter from peanut (Arachis hypogaea L.)
[article]
2020
bioRxiv
pre-print
Preserved Fulltext
LEAFY COTYLEDON1 (LEC1) is a HAP3 subunit of CCAAT-binding transcription factor, which controls several aspects of embryo and postembryo development, including embryo morphogenesis, storage reserve accumulation and skotomorphogenesis. Herein, using the method of chromosomal walking, a 2707bp upstream sequence from the ATG initiation codon site of AhLEC1A which is a homolog of Arabidopsis LEC1 was isolated in peanut. Its transcriptional start site confirmed by 5' RACE was located at 82 nt from
doi:10.1101/2020.11.13.381327
fatcat:f6dcqr7z4ndcxfc735x555timq
more »
... upstream of ATG. The bioinformatics analysis revealed that there existed many tissue-specific elements and light responsive motifs in its promoter. To identify the functional region of the AhLEC1A promoter, seven plant expression vectors expressing the GUS (β-glucuronidase) gene, driven by 5' terminal series deleted fragments of AhLEC1A promoter, were constructed and transformed into Arabidopsis. Results of GUS histochemical staining showed that the regulatory region containing 82bp of 5' UTR and 2228bp promoter could facilitate GUS to express preferentially in the embryos at different development periods of Arabidopsis. Taken together, it was inferred that the expression of AhLEC1A during seed development of peanut might be controlled positively by several seed-specific regulatory elements, as well as negatively by some other regulatory elements inhibiting its expression in other organs. Moreover, the GUS expression pattern of transgenic seedlings in darkness and in light was relevant to the light-responsive elements scattered in AhLEC1A promoter segment, implying that these light-responsive elements harbored in the AhLEC1A promoter regulate skotomorphogenesis of peanut seeds, and AhLEC1A expression was inhibited after the germinated seedlings were transferred from darkness to light.
Evaluation of Severity of Infectious Pneumonia for Newborn Using Ultrasound Image under Adaptive Image Denoising Algorithm
2021
Scientific Programming
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2022; you can also visit the original URL.
The file type is application/pdf.
This study was to analyze the ultrasound imaging characteristics of infectious pneumonia of newborn in different conditions and the differences in neurobehavioral development. An adaptive image denoising (AID) algorithm was constructed based on multiscale wavelet features. It was compared with the transform domain denoising (TDD) algorithm and spatial domain denoising (SDD) algorithm and applied to ultrasound images of newborns with infectious pneumonia. It was found that the peak
doi:10.1155/2021/6191448
doaj:c97d3a085c524a2d923cac8fcdb9161a
fatcat:vbulyh5q6fdlfe6dhie3hx26b4
more »
... e ratio (PSNR), structural similarity (SSIM), and feature similarity index (FSIM) of the constructed algorithm were higher than those of the TDD and SDD algorithms (P<0.05). The ultrasound scores of newborns in noncritical group (group A, 1.54 ± 0.62 scores) were all lower than those of the critical group (group B, 3.96 ± 0.41 scores) and extremely critical group (group C, 4.25 ± 0.35 scores) (P<0.05). The behavioral ability, passive muscle tension, active muscle tension, and original reflection of the newborns in group A were better than other groups (P<0.05). It indicated that the constructed algorithm showed better denoising effect on ultrasound images, which could effectively evaluate the severity of newborns' infectious pneumonia.
LncRNA PVT1 Promotes Hypoxia-Induced Cardiomyocyte Injury by Inhibiting miR-214-3p
2021
BioMed Research International
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2021; you can also visit the original URL.
The file type is application/pdf.
Authors' Contributions Chuanliang Liu and Jieqiong Zhang performed the experiments, analyzed data, and wrote the manuscript. Xuejie Lun and Lei Li designed the study. ...
doi:10.1155/2021/4604883
pmid:34820454
pmcid:PMC8608544
fatcat:uqnassnegjaf3jjqmdmilfa7zi
Clinical features and risk factors for irritable bowel syndrome in Migraine patients
2017
Pakistan Journal of Medical Sciences
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2019; you can also visit the original URL.
The file type is application/pdf.
Objective: Clinical and basic research increasingly suggests a correlation between migraine and irritable bowel syndrome (IBS). In this study, we aimed to explore the clinical features and risk factors for IBS in migraine patients. Methods: This was a retrospective, cross-sectional study. A total of 1,112 consecutive patients from the internal medicine and emergency departments of three hospitals from June 2014 through 2016. A comprehensive interviewer-administered questionnaire was designed
doi:10.12669/pjms.333.12379
pmid:28811802
pmcid:PMC5510134
fatcat:cjyxkhd76rblth3n2jwca3xbtm
more »
... ed on the International Classification of Headache Disorders, 3rd edition (beta version). Results: The response rate was 94.6%. Among 1,052 participants, 287 suffered from migraine (27.3%) and 312 suffered from IBS (29.7%). A total of 79 patients suffered from both migraine and IBS (comorbidity rate: 7.5%). The migraine cohort exhibited a higher frequency of IBS than did the comparison cohort at baseline (P<0.05). Migraine patients with higher headache frequency, longer length of headache history, and anxiety disorders were more likely to also suffer from IBS (P=0.015). There were no significant differences between the two groups in age, sex, family history, duration of headache attack, migraine aura, headache intensity, or depression disorders (P>0.05). Multiple regression analysis indicated length of headache history and headache frequency were associated with IBS. Conclusion: Migraine patients with a long headache history, recurrent episodic headache attacks, and anxiety were more likely to have IBS. L. Clinical features and risk factors for irritable bowel syndrome in Migraine patients. Pak J Med Sci. 2017;33(3):720-725. doi: https://doi.
Cloning and functional characterization of seed-specific LEC1A promoter from peanut (Arachis hypogaea L.)
2021
PLoS ONE
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2021; you can also visit the original URL.
The file type is application/pdf.
Writing -review & editing: Lei Shan, Shubo Wan. ...
Methodology: Jieqiong Zhu, Guangxia Chen. Resources: Jieqiong Zhu. 7. Roscoe TT, Guilleminot J, Bessoule JJ, Berger F, Devic M. ...
of AhLEC1A
20
AhACTIN7-R
ACCAGAGTCCAGAACAATA
21
AhLEC1A-F
ATACTCATACAGATGATAAC
22
AhLEC1A-R
TGTGGAACAAAAGCAGAAGT
https://doi.org/10.1371/journal.pone.0242949.t001
Funding acquisition: Lei ...
doi:10.1371/journal.pone.0242949
pmid:33750972
fatcat:xslsyfokjrbyjatgck2vlybeou
A Newfound Association between MDC1 Functional Polymorphism and Lung Cancer Risk in Chinese
2014
PLoS ONE
Preserved Fulltext
The Internet Archive has a preservation copy of this work in our general collections.
The file type is application/pdf.
Mediator of DNA damage checkpoint protein 1 (MDC1) plays an early and core role in Double-Strand Break Repair (DDR) and ataxia telangiectasia-mutated (ATM) mediated response to DNA double-strand breaks (DSBs), and thus involves the pathogenesis of several DNA damage-related diseases such as cancer. We hypothesized that the single nucleotide polymorphisms (SNPs) of MDC1 which have potencies on affecting MDC1 expression or function were associated with risk of lung cancer. In a two-stage
doi:10.1371/journal.pone.0106794
pmid:25198518
pmcid:PMC4157800
fatcat:vyfnwoouqraincfodoofxv5ei4
more »
... rol study, we tested the association between 5 putatively functional SNPs of MDC1 and lung cancer risk in a southern Chinese population, and validated the promising association in an eastern Chinese population. We found the SNP rs4713354A.C that is located in the 59-untranslated region of MDC1 was significantly associated with lung cancer risk in both populations (P = 0.024), with an odds ratio as 1.23(95% confidence interval = 1.35-1.26) for the rs4713354C (CA+CC) genotypes compared to the rs4713354AA genotype. However, no significant association was observed between other SNPs and lung cancer risk. The gene-based analysis rested with these SNPs suggested the MDC1 as a susceptible gene for lung cancer (P = 0.009). Moreover, by querying the gene expression database, we further found that the rs4713354C genotypes confer a significantly lower mRNA expression of MDC1 than the rs4713354AA genotype in 260 cases of lymphoblastoid cells (P = 0.002). Our data suggested that the SNP rs4713354A.C of MDC1 may be a functional genetic biomarker for susceptibility to lung cancer in Chinese.
Metoprolol alleviates arginine vasopressin-induced cardiomyocyte hypertrophy by upregulating the AKT1–SERCA2 cascade in H9C2 cells
2020
Cell & Bioscience
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
Arginine vasopressin (AVP) is elevated in patients with heart failure, and the increase in the AVP concentration in plasma is positively correlated with disease severity and mortality. Metoprolol (Met) is a beta blocker that is widely used in the clinic to treat pathological cardiac hypertrophy and to improve heart function. However, the specific mechanism by which Met alleviates AVP-induced pathological cardiac hypertrophy is still unknown. Our current study aimed to evaluate the inhibitory
doi:10.1186/s13578-020-00434-y
pmid:32489586
pmcid:PMC7247229
fatcat:jissrixlb5hgrfqcce5rwhiyzq
more »
... ects of Met on AVP-induced cardiomyocyte hypertrophy and the underlying mechanisms. AVP alone or AVP plus Met was added to the wild type or AKT1-overexpressing rat cardiac H9C2 cell line. The cell surface areas and ANP/BNP/β-MHC expressions were used to evaluate the levels of hypertrophy. Western bolting was used to analyze AKT1/P-AKT1, AKT2/P-AKT2, total AKT, SERCA2, and Phospholamban (PLN) expression. Fluo3-AM was used to measure the intracellular Ca2+ stores. In the current study, we found that AKT1 but not AKT2 mediated the pathogenesis of AVP-induced cardiomyocyte hypertrophy. Sustained stimulation (48 h) with AVP led to hypertrophy in the H9C2 rat cardiomyocytes, resulting in the downregulation of AKT1 (0.48 fold compared to control) and SERCA2 (0.62 fold), the upregulation of PLN (1.32 fold), and the increase in the cytoplasmic calcium concentration (1.52 fold). In addition, AKT1 overexpression increased the expression of SERCA2 (1.34 fold) and decreased the expression of PLN (0.48 fold) in the H9C2 cells. Moreover, we found that Met could attenuate the AVP-induced changes in AKT1, SERCA2 and PLN expression and decreased the cytoplasmic calcium concentration in the H9C2 cells. Our results demonstrated that the AKT1-SERCA2 cascade served as an important regulatory pathway in AVP-induced pathological cardiac hypertrophy.
CCL20 secreted from IgA1-stimulated human mesangial cells recruits inflammatory Th17 cells in IgA nephropathy
2017
PLoS ONE
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2019; you can also visit the original URL.
The file type is application/pdf.
IgA nephropathy (IgAN) is the most common primary glomerulonephritis characterized by human mesangial cells (HMC) proliferation and extracellular matrix expansion associated with immune deposits consisting of galactose-deficient IgA1. However, how IgA1 contributes to IgAN has yet to be completely elucidated. In this study, the expression profile of chemokines was more altered in IgA1-treated HMC than in the control group. CCL20 was significantly higher either in the serum of IgAN patients or in
doi:10.1371/journal.pone.0178352
pmid:28552941
pmcid:PMC5446182
fatcat:fbrcgjsyavd6pmghoiha6a46fe
more »
... IgA1-treated HMC. Further experiments demonstrated that CCR6, the only receptor of CCL20, was highly expressed in activated T cells. Intracellular staining assay and cytokine expression profile implied that CCR6 + T cells produced high IL-17 levels. Transwell experiment immunohistochemistry and immunofluorescence experiments extensively demonstrated that CCL20 could recruit inflammatory Th17 cells to the kidneys. These phenomena caused a series of immune inflammatory responses and further damaged the kidneys. Therefore, HMC stimulated by IgA1 could produce CCL20 and consequently recruit inflammatory Th17 cells to the kidneys to induce further lesion in IgA nephropathy. OPEN ACCESS Citation: Lu G, Zhang X, Shen L, Qiao Q, Li Y, Sun J, et al. (2017) CCL20 secreted from IgA1stimulated human mesangial cells recruits inflammatory Th17 cells in IgA nephropathy. PLoS ONE 12(5): e0178352. https://doi.org/10.
Removal of reactive dyes by a solid waste product from food processing: crayfish carapace
2013
Desalination and Water Treatment
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
A B S T R A C T Crayfish carapace micropowder (CM), an economical and environmentally benign material, was used as adsorbents to remove reactive black 5(RB-5) and reactive yellow K-4G (RY-K4G) textile dye from aqueous effluents. The batch adsorption system was evaluated in relation to pH, ionic strength, contact time, initial dye concentration and temperature. Combined alkaline and acidic condition, the absorption capacity was enhanced. Ninety percent of the dyes could be removed by CM when the
doi:10.1080/19443994.2013.811117
fatcat:2lqi2jdvtfbjlkqb6puaz3ssda
more »
... adsorption experiment was carried out under pH 10 for 2 h and then pH 2 for 30 min. The exothermic adsorption of both dyes onto CM was better fit by the pseudo-second-order kinetic. The adsorption isotherms of RB5 followed the Langmuir model, while that of RY-K4G fitted the Freundlich model, with their maximal adsorption capacity of 285and 1299 mg g À1 at pH 2 and 303 K. The possible mechanism was proposed that nucleophilic addition or substitution occurred between CM and reactive dyes under alkaline condition and then electrostatic adsorption appeared between CM and reactive dyes in the acid condition. The adsorption capacity of this low-cost adsorbent is much larger than other adsorbents. Meanwhile, the used adsorbents were successfully applied to adsorb a cationic dye directly at a particular condition in the secondary adsorption. CM can be an economical and promising adsorbent in the wastewater treatment.
Construction and Reform of the Course System of Principles of Chemical Engineering under the Background of Engineering Education Certification
2021
University Chemistry
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2021; you can also visit the original URL.
The file type is application/pdf.
The curriculum system of principles of chemical engineering includes three segments: principles of chemical engineering, laboratory of principles of chemical engineering and curriculum design of principles of chemical engineering. This course is of great significance to guide students to establish cultivate scientific engineering thinking methods and engineering consciousness. It is also very important for improving students' engineering practice skills and engineering quality, the two
doi:10.3866/pku.dxhx202012044
fatcat:tc76qrhvgbcxvpf3l7ocwz422u
more »
... abilities for engineering technicians. Starting from the above three segments, this paper discusses the methods of curriculum reform for three courses under the background of engineering education certification and new engineering construction, so as to fundamentally improve the teaching quality of chemical engineering principle curriculum system and train qualified engineering students who can really solve the practical problems of Engineering.
Hsp20 Protects against Oxygen-Glucose Deprivation/Reperfusion-Induced Golgi Fragmentation and Apoptosis through Fas/FasL Pathway
2015
Oxidative Medicine and Cellular Longevity
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2019; you can also visit the original URL.
The file type is application/pdf.
Cerebral ischemia-reperfusion injury plays an important role in the development of tissue injury after acute ischemic stroke. Finding effective neuroprotective agents has become a priority in the treatment of ischemic stroke. The Golgi apparatus (GA) is a pivotal organelle and its protection is an attractive target in the treatment of cerebral ischemia-reperfusion injury. Protective effects of Hsp20, a potential cytoprotective agent due to its chaperone-like activity and involvement in
doi:10.1155/2015/606934
pmid:26199678
pmcid:PMC4495232
fatcat:y5kfxj77szekhcdueq6iknchdi
more »
... n of many vital processes, on GA were assessed in an ischemia-reperfusion injury model. Mouse neuroblastoma Neuro2a (N2a) cells were subjected to oxygen-glucose deprivation/reperfusion (OGDR) insult. OGDR induces Golgi fragmentation, apoptosis, and p115 cleavage in N2a cells. However, transfection with Hsp20 significantly attenuates OGDR-induced Golgi fragmentation and apoptosis. Hsp20 interacts with Bax, decreases FasL and Bax expression, and inhibits caspases 3 and p115 cleavage in N2a cells exposed to OGDR. Our data demonstrate that increased Hsp20 expression protects against OGDR-induced Golgi fragmentation and apoptosis, likely through interaction with Bax and subsequent amelioration of the OGDR-induced elevation in p115 cleavage via the Fas/FasL signaling pathway. This neuroprotective potential of Hsp20 against OGDR insult and the underlying mechanism will pave the way for its potential clinical application for cerebral ischemia-reperfusion related disorders.
Tuberculosis infection screening in children with close contact: a hospital-based study
2021
BMC Infectious Diseases
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2021; you can also visit the original URL.
The file type is application/pdf.
Background Identifying and prioritizing at-risk populations is critical for pediatric tuberculosis control. We aimed to identify a latent tuberculosis infection (LTBI) screening strategy that is appropriate for the Chinese context among children with different TB exposure levels and to explore its clinical importance. Methods During 2013–2015, we enrolled hospitalized children with suspected respiratory infectious disease (RID) for LTBI screening using the tuberculin skin test (TST) and
doi:10.1186/s12879-021-06480-2
pmid:34388985
pmcid:PMC8364055
fatcat:7cd52wqtavfkplifb2j6gqe6ua
more »
... on-γ release assay (IGRA) T-SPOT.TB as part of a work up for their RID. Participants with confirmed diagnosis were classified into three subgroups according to level of exposure to TB: no reported contact risk, with household contact risk, and with non-household contact risk. Results A total 6202 children (median age: 4.76 years; interquartile range: 1.0–8.0 years) were enrolled. Children with no reported contact risk had the lowest proportions of positive results for the IGRA (0.7%) and TST (3.3%). The proportion of positive results for each test was higher for household contacts than non-household contacts. The TST positive proportion was much higher than that for the IGRA in all three groups. Children with IGRA+/TST+ results had larger indurations than those with IGRA− /TST+ results (15 mm vs. 13 mm, P = 0.02). For IGRA, older age (> 5 years) and non-household or household contact risk were associated with a positive result. Conclusions Positive IGRA results in children with a contact risk can serve as a critical reference for LTBI management. IGRA can be used, in preference to TST, for Chinese children with a TB exposure risk.
Model validation of solar PV plant with hybrid data dynamic simulation based on fast-responding generator method
2016
MATEC Web of Conferences
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2018; you can also visit the original URL.
The file type is application/pdf.
In recent years, a significant number of large-scale solar photovoltaic (PV) plants have been put into operation or been under planning around the world. The model accuracy of solar PV plant is the key factor to investigate the mutual influences between solar PV plants and a power grid. However, this problem has not been well solved, especially in how to apply the real measurements to validate the models of the solar PV plants. Taking fastresponding generator method as an example, this paper
doi:10.1051/matecconf/20166502006
fatcat:gmvvvfhfrzhbhay7axf2ln2mmq
more »
... sents a model validation methodology for solar PV plant via the hybrid data dynamic simulation. First, the implementation scheme of hybrid data dynamic simulation suitable for DIgSILENT PowerFactory software is proposed, and then an analysis model of solar PV plant integration based on IEEE 9 system is established. At last, model validation of solar PV plant is achieved by employing hybrid data dynamic simulation. The results illustrate the effectiveness of the proposed method in solar PV plant model validation.
Genome-Wide Identification of NAC Transcription Factors and Their Functional Prediction of Abiotic Stress Response in Peanut
2021
Frontiers in Genetics
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2021; you can also visit the original URL.
The file type is application/pdf.
The NAC transcription factor (TF) is one of the most significant TFs in plants and is widely involved in plant growth, development, and responses to biotic and abiotic stresses. To date, there are no systematic studies on the NAC family in peanuts. Herein, 132 AhNACs were identified from the genome of cultivated peanut, and they were classified into eight subgroups (I–VIII) based on phylogenetic relationships with Arabidopsis NAC proteins and their conserved motifs. These genes were unevenly
doi:10.3389/fgene.2021.630292
pmid:33767732
pmcid:PMC7985091
fatcat:ekengspkkzaebk5xjgjxidsr2u
more »
... ttered on all 20 chromosomes, among which 116 pairs of fragment duplication events and 1 pair of tandem duplications existed. Transcriptome analysis showed that many AhNAC genes responded to drought and abscisic acid (ABA) stresses, especially most of the members in groups IV, VII, and VIII, which were expressed at larger differential levels under polyethylene glycol (PEG) and/or ABA treatment in roots or leaves. Furthermore, 20 of them selected in response to PEG and ABA treatment were evaluated by quantitative real-time polymerase chain reaction. The results showed that these genes significantly responded to drought and ABA in roots and/or leaves. This study was helpful for guiding the functional characterization and improvement of drought-resistant germplasms in peanuts.
Determination of manganese content in cottonseed meal using near-infrared spectrometry and multivariate calibration
2019
Journal of Cotton Research
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
Manganese (Mn) is an essential microelement in cottonseeds, which is usually determined by the techniques relied on hazardous reagents and complex pretreatment procedures. Therefore a rapid, low-cost, and reagent-free analytical way is demanded to substitute the traditional analytical method. Results: The Mn content in cottonseed meal was investigated by near-infrared spectroscopy (NIRS) and chemometrics techniques. Standard normal variate (SNV) combined with first derivatives (FD) was the
doi:10.1186/s42397-019-0030-5
fatcat:bg3a4erh25aszdkxppxhmyrcx4
more »
... al spectra pre-treatment method. Monte Carlo uninformative variable elimination (MCUVE) and successive projections algorithm method (SPA) were employed to extract the informative variables from the full NIR spectra. The linear and nonlinear calibration models for cottonseed Mn content were developed. Finally, the optimal model for cottonseed Mn content was obtained by MCUVE-SPA-LSSVM, with root mean squares error of prediction (RMSEP) of 1.994 6, coefficient of determination (R 2 ) of 0.949 3, and the residual predictive deviation (RPD) of 4.370 5, respectively. Conclusions: The MCUVE-SPA-LSSVM model is accuracy enough to measure the Mn content in cottonseed meal, which can be used as an alternative way to substitute for traditional analytical method.
« Previous
Showing results 1 — 15 out of 231 results