Filters








8,362 Hits in 2.9 sec

Mouse cell line authentication

Jamie L. Almeida, Carolyn R. Hill, Kenneth D. Cole
2013 Cytotechnology (Dordrecht)  
Vero cells) (Hill et al. 2009; Almeida et al. 2011 ).  ...  R: GTTTCTTCATGTGGCTGGTATGCTGTT 0.075 9-2 NT_039474.8 74395400-74395000 F: [VIC]-GGATTGCCAAGAATTTGAGG R: GTTTCTTTCCTGAGTTGTGGACAGGGTTA 0.080 15-3 NT_039617.8 4930200-4930500 F: [NED]-  ... 
doi:10.1007/s10616-013-9545-7 pmid:23430347 pmcid:PMC3886540 fatcat:wq26y3idyjdqlcmnyf3ztyyzyq

Memoir: template-based structure prediction for membrane proteins

Jean-Paul Ebejer, Jamie R. Hill, Sebastian Kelm, Jiye Shi, Charlotte M. Deane
2013 Nucleic Acids Research  
Membrane proteins are estimated to be the targets of 50% of drugs that are currently in development, yet we have few membrane protein crystal structures. As a result, for a membrane protein of interest, the much-needed structural information usually comes from a homology model. Current homology modelling software is optimized for globular proteins, and ignores the constraints that the membrane is known to place on protein structure. Our Memoir server produces homology models using alignment and
more » ... coordinate generation software that has been designed specifically for transmembrane proteins. Memoir is easy to use, with the only inputs being a structural template and the sequence that is to be modelled. We provide a video tutorial and a guide to assessing model quality. Supporting data aid manual refinement of the models. These data include a set of alternative conformations for each modelled loop, and a multiple sequence alignment that incorporates the query and template. Memoir works with both a-helical and b-barrel types of membrane proteins and is freely available at
doi:10.1093/nar/gkt331 pmid:23640332 pmcid:PMC3692111 fatcat:az47ghyxfrfjbo4s2qz4inizji

MP-T: improving membrane protein alignment for structure prediction

Jamie R. Hill, Charlotte M. Deane
2012 Computer applications in the biosciences : CABIOS  
In previous work, we performed pairwise alignment of a sequence on to a template (Hill et al., 2011) .  ...  In previous work, we demonstrated that environment-specific substitution tables improved the pairwise alignment of membrane proteins (Hill et al., 2011) .  ... 
doi:10.1093/bioinformatics/bts640 pmid:23110969 fatcat:sv3kgc6yy5hy7ectfc33okg324

Authentication of African green monkey cell lines using human short tandem repeat markers

Jamie L Almeida, Carolyn R Hill, Kenneth D Cole
2011 BMC Biotechnology  
R -GATTGAACCAGATGGGAACGA 354-374 59 D17S1304 F -ACCATGTCCTCTGGTTCTGG R - GTTTCTTACAGGTGGGACTTGGTGAAA 197-213 60 D4S2408 F -TCATTTCCATAGGGTAAGTGAAAA R -GCCATGGGGATAAAATCAGA 336-360 60  ...  * 267-291 55 DYS389 F -CCAACTCTCATCTGTATTATCTATG R -GTCTTATCTCCACCCACCAGA 321-337 60 D1S518 F -GCAGATCTTGGGACTTCTCG R -GTGTGGGCAACTGCATTAGAG 182-198 55 D6S1017 F -CTGGCACAGGATAGGTGCTC  ... 
doi:10.1186/1472-6750-11-102 pmid:22059503 pmcid:PMC3221628 fatcat:hsnaayvvfjhplj5umnddgdhyha

Sinusoidal Voltage Protocols For Rapid Characterisation Of Ion Channel Kinetics [article]

Kylie A Beattie, Adam P Hill, Rémi Bardenet, Yi Cui, Jamie I Vandenberg, David J Gavaghan, Teun P de Boer, Gary R Mirams
2017 bioRxiv   pre-print
We chose 217 to use 0.3 µM because the dofetilide hERG IC 50 value is <10 nM which, assuming a Hill coefficient 218 of one, should correspond to >97% conductance block of I Kr at 0.3 µM dofetilide.  ...  similar conditions/species. 187 Leak Corrections 188 We used the leak-step from −80 mV to −120 mV in order to leak-correct the experimental data, 189 according to: 190 I corrected = I raw − V /R  ... 
doi:10.1101/100677 fatcat:acifpx43gjdh5minsxhxzacaxu

First-generation shaped gel reactors based on photo-patterned hybrid hydrogels

Phillip R. A. Chivers, Jamie A. Kelly, Max J. S. Hill, David K. Smith
2020 Reaction Chemistry & Engineering  
This paper reports the development of first-generation photo-patterned ring-shaped gel reactors that catalyse the hydrolysis of para-nitrophenol phosphate using a phosphatase enzyme.
doi:10.1039/d0re00109k fatcat:kvmp7nznc5azlb7heaqzppwby4

Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis

S. Huang, R. D. Hill, O. S. D. Wally, G. Dionisio, B. T. Ayele, S. K. Jami, C. Stasolla
2014 Plant Physiology  
Expression of AtKOD was detected by quantitative RT-PCR, Taqman technology using AtKOD-F/R with AtKOD-FAM probe, and Actin1-F/R with Actin1-HEX probe (Supplemental Table S1 ).  ...  In plants, Hbs are regulated by many abiotic and biotic stress responses characterized by the manifestation of PCD (Hill, 2012) .  ... 
doi:10.1104/pp.114.239335 pmid:24784758 pmcid:PMC4044835 fatcat:rfcxtqh2jrfopax4ctyzzydic4

Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics

Kylie A. Beattie, Adam P. Hill, Rémi Bardenet, Yi Cui, Jamie I. Vandenberg, David J. Gavaghan, Teun P. de Boer, Gary R. Mirams
2018 Journal of Physiology  
Key points r Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these.  ...  are affected by changing conditions. r The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models.  ...  Leak corrections We used the leak step from −80 to −120 mV in order to leak-correct the experimental data, according to: I corrected = I raw − V R leak . (2) We identified the most appropriate R leak value  ... 
doi:10.1113/jp275733 pmid:29573276 pmcid:PMC5978315 fatcat:3gns5ekpuvd4rfoke2my5uloxe

Corrosion Characteristics of Laser-Engineered Net Shaping Additively-Manufactured 316L Stainless Steel

Jamie A. Stull, Mary Ann Hill, Thomas J. Lienert, Justin Tokash, Kevin R. Bohn, Daniel E. Hooks
2018 JOM: The Member Journal of TMS  
doi:10.1007/s11837-018-3123-6 fatcat:dfqyqst3dfakbptewkzl47rgeq

Characterization of Aluminum-Neutralized Sulfonated Styrenic Pentablock Copolymer Films

Geoffrey M. Geise, Carl L. Willis, Cara M. Doherty, Anita J. Hill, Timothy J. Bastow, Jamie Ford, Karen I. Winey, Benny D. Freeman, Donald R. Paul
2012 Industrial & Engineering Chemistry Research  
Free volume information was obtained from the o-Ps lifetime data using the Tao-Eldrup model to relate the o-Ps lifetime to the average radius, r, of a free volume element 65 where Δr is the empirical  ...  . = ̅ Δ − Δπ P n lRT V p [ ] w w w (6) where R is the gas constant, V̅ w is the molar volume of water (18 cm 3 mol −1 ), 61 and Δπ is the osmotic pressure difference, which was zero for pure water permeability  ... 
doi:10.1021/ie202546z fatcat:yl5tqiisi5abthsnuqsqxszrjq

Inactivation of RASA1 promotes melanoma tumorigenesis via R-Ras activation

Hyeran Sung, Krishna L. Kanchi, Xue Wang, Kristen S. Hill, Jane L. Messina, Ji-Hyun Lee, Youngchul Kim, Nathan D. Dees, Li Ding, Jamie K. Teer, Shengyu Yang, Amod A. Sarnaik (+5 others)
2016 OncoTarget  
RAS viral (r-ras) oncogene homolog) isoform.  ...  Moreover, R-Ras increased and RASA1 suppressed Ral-A activation among Ras downstream effectors.  ...  We also have shown that RASA1 functions as a RasGAP for the R-Ras isoform.  ... 
doi:10.18632/oncotarget.8127 pmid:26993606 pmcid:PMC5029671 fatcat:xzgilr6e75dd5b6tl3epdpnc7y

sj-pdf-1-pul-10.1177_20458940211025240 - Supplemental material for Vascular cell-specific roles of mineralocorticoid receptors in pulmonary hypertension

Divya P. Menon, Guanming Qi, Seung K. Kim, M. Elizabeth Moss, Krishna C. Penumatsa, Rod R. Warburton, Deniz Toksoz, Jamie Wilson, Nicholas S. Hill, Iris Z. Jaffe, Ioana R. Preston
2021 Figshare  
Penumatsa, Rod R. Warburton, Deniz Toksoz, Jamie Wilson, Nicholas S. Hill, Iris Z. Jaffe and Ioana R. Preston: On behalf of THALES Registry Investigators in Pulmonary Circulation  ... 
doi:10.25384/sage.14810912.v1 fatcat:wfhr5vge2bcahpdaaog7fiyyiq

Increased Islet Cell Proliferation, Decreased Apoptosis, and Greater Vascularization Leading to β-Cell Hyperplasia in Mutant Mice Lacking Insulin

B. Duvillié, C. Currie, T. Chrones, D. Bucchini, J. Jami, R. L. Joshi, D. J. Hill
2002 Endocrinology  
R.  ... 
doi:10.1210/endo.143.4.8753 pmid:11897712 fatcat:bzb7m3546ncvzjn3ftbfuk7h5y

Strategies and challenges associated with recruiting retirement village communities and residents into a group exercise intervention

Rachel L. Duckham, Jamie L. Tait, Caryl A. Nowson, Kerrie M. Sanders, Dennis R. Taaffe, Keith D. Hill, Robin M. Daly
2018 BMC Medical Research Methodology  
Randomized controlled trials (RCTs) provide the highest level of scientific evidence, but successful participant recruitment is critical to ensure the external and internal validity of results. This study describes the strategies associated with recruiting older adults at increased falls risk residing in retirement villages into an 18-month cluster RCT designed to evaluate the effects of a dual-task exercise program on falls and physical and cognitive function.
doi:10.1186/s12874-018-0633-4 pmid:30572835 pmcid:PMC6302307 fatcat:floysif3irbrzhv2gp4s4xd72u

BronchUK: Protocol for an observational cohort study and biobank in bronchiectasis

Anthony De Soyza, Philip Mawson, Adam T. Hill, Stuart Elborn, Judy M. Bradley, Charles S. Haworth, R. Andres Floto, Robert Wilson, Michael R. Loebinger, Mary Carroll, Megan Crichton, James D. Chalmers (+12 others)
2021 ERJ Open Research  
Hill has nothing to disclose. J.S.  ...  R. Wilson has nothing to disclose. M.R.  ... 
doi:10.1183/23120541.00775-2020 pmid:33898620 pmcid:PMC8053912 fatcat:jakejxi4qbcmfa4lmh4c5c3roi
« Previous Showing results 1 — 15 out of 8,362 results