A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
Filters
Baseline susceptibility and cross-resistance inAphis gossypii Glover (Aphididae: Hemiptera) to phorate and sulfoxaflor
2013
Austral Entomology
Preserved Fulltext
However, there has been an increase in populations of sucking insect pests such as green mirid Creontiades dilutus (Stål) and cotton aphid Aphis gossypii Glover (Fitt et al. 1994) with consequent increase ...
doi:10.1111/aen.12047
fatcat:fwpxqhc3k5dvjlpnscwy3fqzim
Quantification of the Pirimicarb Resistance Allele Frequency in Pooled Cotton Aphid (Aphis gossypii Glover) Samples by TaqMan SNP Genotyping Assay
2014
PLoS ONE
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
Our results show that k' is reproducible and highly correlated with RAF (r .0.99). ...
The cotton or melon aphid, Aphis gossypii Glover is a serious pest of many crop species including cotton, pumpkin, citrus and melons [10] . ...
Therefore R can be predicted by the ratio R' = DR n A/DR n B. ...
doi:10.1371/journal.pone.0091104
pmid:24614533
pmcid:PMC3948748
fatcat:2dh55sgsx5hqbpllfjk6f3qeme
Atomic, Molecular, and Optical Physics in the Early Universe: From Recombination to Reionization
[chapter]
2014
Advances In Atomic, Molecular, and Optical Physics
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2014; you can also visit the original URL.
The file type is application/pdf.
Therefore, the total density in radiation at the present time is approximately Ω r = Ω r,photons + Ω r,neutrinos = 8.9 × 10 −5 . ...
More comprehensive reviews can be found in Yoshida (2011), Glover (2013) , and Bromm (2013). ...
doi:10.1016/b978-0-12-800129-5.00003-1
fatcat:uxl3hvyxirbirg3yerayygiaqq
The Hydrogen Bike: Communicating the Production and Safety of Green Hydrogen
2021
Frontiers in Communication
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2021; you can also visit the original URL.
The file type is application/pdf.
As the international community aims to reduce its reliance on fossil fuels, green hydrogen has great potential to replace methane as a clean source of fuel. A novel public engagement activity, The Hydrogen Bike, has been developed to demonstrate the production and use of green hydrogen from water. The aim of the activity is to educate, entertain and inform young people and adults so that they have an opportunity to form an opinion about the use of hydrogen as a fuel. Using a novel two-part data
doi:10.3389/fcomm.2020.540635
fatcat:x3econngznbwtoz5fj7utskijm
more »
... collection system participants are briefly surveyed for their opinion on hydrogen before and after participating in The Hydrogen Bike activity. Through this we have found that most participants (73%) are considered to have no opinion or a neutral opinion on hydrogen before participating in The Hydrogen Bike activity. After participation 88% of those who were originally neutral or had no opinion on hydrogen self-reported a positive feeling about hydrogen. The method of data collection was quick, intuitive and suitable for an audience attracted from passing footfall.
Generation and Validation of Monoclonal Antibodies Against the Maltose Binding Protein
2016
Monoclonal antibodies in immunodiagnosis and immunotherapy
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
GAPDH was amplified from the plasmid with the primers GAPDH-F (ATATGGT ACCATGGGGAAGGTGAAGGTCGGAG) and GAPDH-R (TATACTCGAGCTACTCCTTGGAGGCCATGTGGGCC). ...
To generate pHis-GFP, GFP was amplified by polymerase chain reaction (PCR) from the plasmid pNIM1 (11) with the primers GFP-F (AT-ATGGTACCATGAGTAAGGGAGAAGAACTTTTCACA) and GFP-R (TATACTCGAGTTATTTGTATAGTTCATC ...
doi:10.1089/mab.2015.0072
pmid:26982821
pmcid:PMC4845686
fatcat:3kftydyqr5fdximmtn5z26pucm
On the Split Personality of Penultimate Proline
2014
Journal of the American Society for Mass Spectrometry
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
The influence of the position of the amino acid proline in polypeptide sequences is examined by a combination of ion mobility spectrometry-mass spectrometry (IMS-MS), amino acid substitutions, and molecular modeling. The results suggest that when proline exists as the second residue from the N-terminus (i.e., penultimate proline), two families of conformers are formed. We demonstrate the existence of these families by a study of a series of truncated and mutated peptides derived from the
doi:10.1007/s13361-014-1049-y
pmid:25503299
pmcid:PMC4336576
fatcat:y7aqwgsmvbaalbkasmus76e7zi
more »
... due peptide Ser 1 -Pro 2 -Glu 3 -Leu 4 -Pro 5 -Ser 6 -Pro 7 -Gln 8 -Ala 9 -Glu 10 -Lys 11 . We find that every peptide from this sequence with a penultimate proline residue has multiple conformations. Substitution of Ala for Pro residues indicates that multiple conformers arise from the cis-trans isomerization of Xaa 1 -Pro 2 peptide bonds as Xaa-Ala peptide bonds are unlikely to adopt the cis isomer, and examination of spectra from a library of 58 peptides indicates that~80% of sequences show this effect. A simple mechanism suggesting that the barrier between the cis-and trans-proline forms is lowered because of low steric impedance is proposed. This observation may have interesting biological implications as well, and we note that a number of biologically active peptides have penultimate proline residues.
Neural Correlates of Auditory Perception in Williams Syndrome: An fMRI Study
2003
NeuroImage
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
We found no statistically significant difference between the two groups in the N Ϫ R condition in this fVOI, nor between the M Ϫ R and N Ϫ R conditions within the WS group. ...
To pursue this possibility, we then looked at the Music minus Rest (M Ϫ R) and Noise minus Rest (N Ϫ R) contrasts (see Fig. 4 ). ...
doi:10.1006/nimg.2002.1297
pmid:12507445
fatcat:7lrdoqfatrhsjl7tgnb3dblhxa
Harvested perennial grasslands provide ecological benchmarks for agricultural sustainability
2010
Agriculture, Ecosystems & Environment
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
Calabresi, R. Curry, J. and B. Duggan, L. Porter, R. Wedel, and W. Wolfe for use of their fields; C.M. Cox, T.S. Cox, D. Van Tassel, and J.P. Reganold for critical comments on the manuscript; M. ...
., 2006; Glover et al., 2007; Jordan et al., 2007) . ...
2 = 0.61, n = 34 and p = 0.0013, r 2 = 0.56, n = 15, respectively). ...
doi:10.1016/j.agee.2009.11.001
fatcat:bo57dbfasbcehdrolm2fbv64ma
Cis→Trans Isomerization of Pro7 in Oxytocin Regulates Zn2+ Binding
2016
Journal of the American Society for Mass Spectrometry
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
Ion mobility/mass spectrometry techniques are employed to investigate the binding of Zn 2+ to the nine-residue peptide hormone oxytocin (OT, Cys 1 -Tyr 2 -Ile 3 -Gln 4 -Asn 5 -Cys 6 -Pro 7 -Leu 8 -Gly 9 -NH 2 , having a disulfide bond between Cys 1 and Cys 6 residues). Zn 2+ binding to OT is known to increase the affinity of OT for its receptor [Pearlmutter, A. F., Soloff, M. S.: Characterization of the metal ion requirement for oxytocin-receptor interaction in rat mammary gland membranes. J.
doi:10.1007/s13361-016-1410-4
pmid:27154022
pmcid:PMC5161230
fatcat:wd5dpyj5bvhcjflh6sv4zrmxie
more »
... ol. Chem. 254, 3899-3906 (1979)]. In the absence of Zn 2+ , we find evidence for two primary OT conformations, which arise because the Cys 6 -Pro 7 peptide bond exists in both the transand cis-configurations. Upon addition of Zn 2+ , we determine binding constants in water of K A = 1.43 ± 0.24 and 0.42 ± 0.12 μM −1 , for the transand cisconfigured populations, respectively. The Zn 2+ bound form of OT, having a cross section of Ω = 235 Å 2 , has Pro 7 in the trans-configuration, which agrees with a prior report [Wyttenbach, T., Liu, D., Bowers, M. T.: Interactions of the hormone oxytocin with divalent metal ions. J. Am. Chem. Soc. 130, 5993-6000 (2008)], in which it was proposed that Zn 2+ binds to the peptide ring and is further coordinated by interaction of the C-terminal, Pro 7 -Leu 8 -Gly 9 -NH 2 , tail. The present work shows that the cis-configuration of OT isomerizes to the trans-configuration upon binding Zn 2+ . In this way, the proline residue regulates Zn 2+ binding to OT and, hence, is important in receptor binding.
Detection of Protein Folding Defects Caused by BRCA1-BRCT Truncation and Missense Mutations
2003
Journal of Biological Chemistry
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2018; you can also visit the original URL.
The file type is application/pdf.
ttc aca cac aag ctc agc atc tgt-3Ј; V1696L, F-5Ј-gat gct gag ttt ttg tgt gaa cgg aca-3Ј, R-5Ј-tgt ccg ttc aca caa aaa ctc agc atc-3Ј; C1697R, F-5Ј-gct gag ttt gtg cgt gaa cgg aca ctg-3Ј, R-5Ј-cag tgt ...
ctg ttc aca cac aaa-3Ј; S1715R, F-5Ј-aaa tgg gta gtt aga tat ttc tgg gtg-3Ј, R-5Ј-cac cca gaa ata tct aac tac cca ttt-3Ј; W1718C, F-5Ј-gtt agc tat ttc tgt gtg acc cag tct-3Ј, R-5Ј-aga ctg ggt cac aca ...
doi:10.1074/jbc.m310182200
pmid:14534301
fatcat:vkrtlaoszbbwpdi5by3aozq4ii
The genomics of trait combinations and their influence on adaptive divergence
[article]
2020
bioRxiv
pre-print
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
one another), intermediate (0.15 < r 2 < 0.6), or low 338 (r 2 < 0.15 with all other SNPs) levels of composite LD identified in Ragland et al. ...
Proceedings of the 871 National Academy of Sciences, 107(21), 9724-9729. doi: 10.1073/pnas.1000939107 872 Michelmore, R. W., Paran, I., & Kesseli, R. V. (1991). ...
doi:10.1101/2020.06.19.161539
fatcat:izmemjl5ongz7eit73jfdh7lte
The relation of worry to prefrontal cortex volume in older adults with and without generalized anxiety disorder
2009
Psychiatry Research : Neuroimaging
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
Despite the widespread prevalence of generalized anxiety disorder (GAD) in later life, almost nothing is known about the neural aspects of worry in adults over the age of 60. Given the ongoing rapid increase in the older adult population, the relatively poor response rates to current interventions for late life GAD, and the effects of agerelated changes to the brain, additional research on worry neurobiology is needed. The study group comprised 15 older GAD patients and 15 matched controls who
doi:10.1016/j.pscychresns.2008.09.010
pmid:19559575
pmcid:PMC5206907
fatcat:og4oeobywbhtbl7ashsanncmve
more »
... ere compared on clinical measures and brain volumes. It was expected that prefrontal cortex (PFC) volumes [medial orbital cortex (mOFC), dorsolateral cortex (DLPFC)] would show positive relations to worry scores, and weaker relations to more general measures of anxiety and depression. Negative relations were expected between amygdala volumes and worry scores. As expected, mOFC volumes were positively related to worry scores; however, DLPFC and amygdala volumes were not. The mOFC is involved in emotional decision-making under uncertain conditions and has the ability to suppress the amygdala, both of which are hypothesized functions of worry. Results are partly consistent with GAD theory and suggest that worry may involve neural areas that are also involved in the successful control of anxiety.
Pregnancy-associated breast cancers are driven by differences in adipose stromal cells present during lactation
2014
Breast Cancer Research
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2019; you can also visit the original URL.
The file type is application/pdf.
Daniel Medina (Baylor University) and the SUM159 cell line was obtained from Dr. Stephen Ethier (Kramanos Institute). ...
Robust multi-array average expression values were computed from arrays using R and Bioconductor software. ...
doi:10.1186/bcr3594
pmid:24405573
pmcid:PMC3978436
fatcat:s77xeyuuhrfihjszyun3pmsso4
Low-volume resistance exercise attenuates the decline in strength and muscle mass associated with immobilization
2010
Muscle and Nerve
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
We determined the effectiveness of low-volume resistance exercise (EX) for the attenuation of loss of muscle mass and strength during leg immobilization. Men (N ¼ 5) and women (N ¼ 12, age 24 6 5 years, body mass index 25.4 6 3.6 kg/m 2 ) were divided into two groups: exercise (EX; n ¼ 12) and control (CON; n ¼ 5). Subjects wore a knee brace on one leg that prevented weight bearing for 14 days. Resistance exercise (EX; 80% of maximal) was performed by the immobilized limb every other day.
doi:10.1002/mus.21721
pmid:20658567
fatcat:d57ddhygkfe2vhx53pwmk5cwby
more »
... lization induced a significant reduction (P < 0.05) in muscle fiber and thigh cross-sectional area (CSA), isometric knee extensor, and plantarflexor strength in the CON (P < 0.01) but not in the EX group. There were significant losses in triceps surae CSA in the CON and EX groups (P < 0.05), but the losses were greater in CON subjects (P < 0.01). A minimal volume (140 contractions in 14 days) of resistive exercise is an effective countermeasure against immobilization-induced atrophy of the quadriceps femoris but is only partially effective for the triceps surae.
Tidying up loose ends: the role of polynucleotide kinase/phosphatase in DNA strand break repair
2011
TIBS -Trends in Biochemical Sciences. Regular ed
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
The termini of DNA strand breaks induced by internal and external factors often require processing before missing nucleotides can be replaced by DNA polymerases and the strands rejoined by DNA ligases. Polynucleotide kinase/phosphatase (PNKP) serves a critical role in the repair of DNA strand breaks by catalyzing the restoration of 5'-phosphate and 3'-hydroxyl termini. It participates in several DNA repair pathways through interactions with other DNA repair proteins, notably XRCC1 and XRCC4.
doi:10.1016/j.tibs.2011.01.006
pmid:21353781
pmcid:PMC3134258
fatcat:vf6zaurdxncpzc5ifrgyltq4gy
more »
... ent studies have highlighted the physiological importance of PNKP in maintaining the genomic stability of normal tissues, particularly developing neural cells, as well as enhancing the resistance of cancer cells to genotoxic therapeutic agents. Damage to cellular DNA is considered to be a significant factor in aging [1], cancer etiology and treatment [2] [3] [4] , and neurological disorders [5] . DNA damage, in the form of base modification, base loss and strand breaks, can be triggered by intracellular agents, primarily reactive oxygen species (ROS), as well as by exogenous agents. As a result, cells have evolved a battery of repair pathways to counter the mutational and cytotoxic consequences of DNA damage [6] . Strand breaks can be produced by various mechanisms, including cleavage by physical and chemical means such as ionizing radiation (IR) and ROS, and by enzymatic processes, such as those mediated by topoisomerases and DNA repair endonucleases. Thus, strand breaks do not constitute a homogeneous class of lesions and, in addition to classification based on cleavage of one or both DNA strands, strand breaks can be further subdivided based on the nature of their termini (Box 1). This review focuses on the enzyme polynucleotide kinase/phosphatase (PNKP) and its role in the repair of DNA strand breaks. PNKP possesses both 5'-kinase and 3'-phosphatase activities that are frequently required for processing of single-and double-strand break (SSB and DSB) termini [7] [8] [9] [10] . PNKP, like several other DNA repair proteins, has become of increasing clinical interest owing to the identification of small molecule inhibitors of these enzymes
« Previous
Showing results 1 — 15 out of 10,005 results