Filters








144,327 Hits in 4.0 sec

Flux and Freund-Rubin superpotentials in M theory

Neil Lambert
<span title="2005-06-03">2005</span> <i title="American Physical Society (APS)"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/chloqzh6grayjgjxdzjq5ktthu" style="color: black;">Physical Review D</a> </i> &nbsp;
We discuss the effective action for weak G_2 compactifications of M-theory. The presence of fluxes acts as a source for the the axions and drives the Freund-Rubin parameter to zero.  ...  2 1 4 V 0 , V ef f = −5 √ 6λ 3 2 7 M 1 2 (19) This is not the Freund-Rubin solution.  ...  exact and hence there can be no topologically non-trivial fluxes if M = 0. 2 This forbids static solutions with both topologically non-trivial fluxes and a non-vanishing Freund-Rubin parameter M.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1103/physrevd.71.126001">doi:10.1103/physrevd.71.126001</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/fdiici4bivac7cqp4eqhxmkwjy">fatcat:fdiici4bivac7cqp4eqhxmkwjy</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20180726140035/http://cds.cern.ch/record/824283/files/0502200.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/1f/da/1fda5189c7616bb89facc101b27a1f39657a789e.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1103/physrevd.71.126001"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> aps.org </button> </a>

Bassiouney Reem (ed.), Arabic and the media. Linguistic analyses and applications, Brill, Leiden-Boston, 2010 in T. Muraoka, C. H. M. Versteegh, A. D. Rubin (eds.), Studi

Myriam Achour Kallel
<span title="2012-06-29">2012</span> <i title="OpenEdition"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/rkxqghfmpbcljiadby4oh22oge" style="color: black;">Revue des Mondes Musulmans et de la Méditerranée</a> </i> &nbsp;
D.  ...  D.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.4000/remmm.7260">doi:10.4000/remmm.7260</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/5yxkv6xg6rcy3bf5jbdya5z6si">fatcat:5yxkv6xg6rcy3bf5jbdya5z6si</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20220326011139/https://journals.openedition.org/remmm/7260" title="fulltext access" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [HTML] </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.4000/remmm.7260"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> Publisher / doi.org </button> </a>

Software tools pacakage one [article]

V. Rollano, I. Gimeno, M. Rubin-Osanz, M. Calero, A. Gomez, D. Zueco, F. Luis
<span title="2021-10-06">2021</span> <i title="Zenodo"> Zenodo </i> &nbsp;
Software tools used in several CSIC publications related to Fatmols. It includes: (1) a 3D magnetic field and coupling spatial distribution calculation package based on CUDA. (2) A software package to calculate the transmission as a function of the external magnetic field and frequency trough a transmission line coupled to a spin ensemble, coupled to a LC resonator, or coupled to a LC resonator-spin ensemble system. (3) A software package to analize the experimental measurements taken with a BF
more &raquo; ... dilution refrigerator. (4) A software package to calculate the fidelity of a SWAP gate between two quantum systems.
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.5281/zenodo.5552617">doi:10.5281/zenodo.5552617</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/4rdo4y2qrjdvfowlw6wwgapeqy">fatcat:4rdo4y2qrjdvfowlw6wwgapeqy</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20211008090206/https://zenodo.org/record/5552617/files/FATMOLS%20SOFTWARE%20LIST.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/84/60/8460981a8a3d57f9eca829ae4f161141fe666e3f.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.5281/zenodo.5552617"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> zenodo.org </button> </a>

Modified torsion coefficients for a 3-D brick Cosserat point element

M. Jabareen, M. B. Rubin
<span title="2007-08-10">2007</span> <i title="Springer Nature"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/rtlsk6fjr5cuvo7ij7b5ac7n4m" style="color: black;">Computational Mechanics</a> </i> &nbsp;
Using this solution, modified torsion coefficients are proposed for a 3-D brick Cosserat point element (CPE) which are shown to improve convergence properties for solutions of pure torsion.  ...  Also, the work of M Jabareen was supported by a contract from the German Israel Foundation (GIF) for collaboration with P. Wriggers and his research group at the University of Hanover.  ...  Using a nonlinear form of the patch test, Nadler and Rubin [11] proposed a form for which is determined by the strain energy function * of the 3-D material and a strain energy function for inhomogeneous  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1007/s00466-007-0208-4">doi:10.1007/s00466-007-0208-4</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/qus7ddttgnbg3f4fhkz2fwrnqq">fatcat:qus7ddttgnbg3f4fhkz2fwrnqq</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20190412231840/https://core.ac.uk/download/pdf/159155487.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/a3/75/a375c2dbdfa0c84217a0d9cf67c7892e5f341551.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1007/s00466-007-0208-4"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> springer.com </button> </a>

Society for General Systems Research (L2)

M. D. Rubin
<span title="1965-02-19">1965</span> <i title="American Association for the Advancement of Science (AAAS)"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/qirzh7firjdsjhg4tutxtir6ey" style="color: black;">Science</a> </i> &nbsp;
MILTON D. RUBIN, Secretary-Treasurer Engineering (M) The Section M meeting was an outstanding success in that it coupled this Section M with other sections having common interests.  ...  The symposium was arranged by Norman Kretchmer (Stanford) in collaboration with James D.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1126/science.147.3660.926-a">doi:10.1126/science.147.3660.926-a</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/17793588">pmid:17793588</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/o4lkgks57jemtpxlpf4m5g6nr4">fatcat:o4lkgks57jemtpxlpf4m5g6nr4</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20180719115038/http://science.sciencemag.org/content/sci/147/3660/926.2.full.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/75/1a/751a66c87ac8cff54295a4285f951a816843b824.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1126/science.147.3660.926-a"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> sciencemag.org </button> </a>

Visual memory loss and autobiographical amnesia: a case study

D GREENBERG, M EACOTT, D BRECHIN, D RUBIN
<span title="">2005</span> <i title="Elsevier BV"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/vtuexoohondejhlk4iamncfka4" style="color: black;">Neuropsychologia</a> </i> &nbsp;
We proposed that amnesia should also result from damage to these regions, particularly regions that subserve long-term visual memory [Rubin, D. C., & Greenberg, D. L. (1998) .  ...  s memory problems, particularly his RA for AM Rubin and Greenberg, 1998) .  ...  We previously reviewed case studies of patients who met these criteria Rubin & Greenberg, 1998) .  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1016/j.neuropsychologia.2004.12.009">doi:10.1016/j.neuropsychologia.2004.12.009</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/15989939">pmid:15989939</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/wlcpvqjir5dt5n3dcbp73orvwi">fatcat:wlcpvqjir5dt5n3dcbp73orvwi</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20170817024802/https://dukespace.lib.duke.edu/dspace/bitstream/handle/10161/10108/GreenbergVisual2005.pdf?sequence=1" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/d1/d8/d1d8f95a18230452d6146a89fa381299151f26a5.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1016/j.neuropsychologia.2004.12.009"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> elsevier.com </button> </a>

A Method for Measuring Emittance in e^+ e^- Colliding Beams [article]

D. Cinabro, K. Korbiak, M. Billing. N. Mistry, D. Rice, D. Rubin
<span title="2002-12-05">2002</span> <i > arXiv </i> &nbsp; <span class="release-stage" >pre-print</span>
Our resolution on the size of the luminous region is about 30µm while our earlier observation showed that the underlying width is about 7µm.  ...  We expected an ǫ x = 0.21µm-rad while we extracted an ǫ x ≈ 0.3µm. These results again agree well with our expectation. We do not clearly see any dynamic effects.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener" href="https://arxiv.org/abs/hep-ex/0212010v1">arXiv:hep-ex/0212010v1</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/lvadxngss5h33ln64gxzq5hdje">fatcat:lvadxngss5h33ln64gxzq5hdje</a> </span>
<a target="_blank" rel="noopener" href="https://archive.org/download/arxiv-hep-ex0212010/hep-ex0212010.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> File Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/90/8c/908cea790aac8b7f3079372f759bf60ebb4efed5.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener" href="https://arxiv.org/abs/hep-ex/0212010v1" title="arxiv.org access"> <button class="ui compact blue labeled icon button serp-button"> <i class="file alternate outline icon"></i> arxiv.org </button> </a>

Nucleotide Conformafions

S. Arnott, D. W. L. Hukins, J. Rubin, T. Brennan, M. Sundaralingam
<span title="1972-08-04">1972</span> <i title="American Association for the Advancement of Science (AAAS)"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/qirzh7firjdsjhg4tutxtir6ey" style="color: black;">Science</a> </i> &nbsp;
M. Miller, M. Glick- stein, W. C. Stebbins, Psychonom. Sci. 5, 177 (1966). 7. W. C. Stebbins, S. Green, F. L. Miller, 45, 966 (1969). 8.  ...  Rubin et al. (1) were concerned also to emphasize the conformational differences between UpA and A-RNA.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1126/science.177.4047.451">doi:10.1126/science.177.4047.451</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/5043149">pmid:5043149</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/wu6cgbe6z5gfncbug36adjifuq">fatcat:wu6cgbe6z5gfncbug36adjifuq</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20180723090137/http://science.sciencemag.org/content/sci/177/4047/451.full.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/89/1f/891f6d5d18cdc30937727f773cacaafd26bc9658.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1126/science.177.4047.451"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> sciencemag.org </button> </a>

ISO measurements of [CII] line variations in galaxies [article]

S. Malhotra, G. Helou, D. Hollenbach, D. A. Hunter, R. H. Rubin, M. W. Werner
<span title="1997-10-21">1997</span> <i > arXiv </i> &nbsp; <span class="release-stage" >pre-print</span>
(D) The dominant PDR cooling lines [CII] and [OI] could be weak or missing if most of the FIR emission is from dust in high density HII regions (c.f. point (c) in section 3.2).  ...  (F ν (60µm)/F ν (100µm)).  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener" href="https://arxiv.org/abs/astro-ph/9710220v1">arXiv:astro-ph/9710220v1</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/xmj75wl2ibgjratmm5h7pzczfu">fatcat:xmj75wl2ibgjratmm5h7pzczfu</a> </span>
<a target="_blank" rel="noopener" href="https://archive.org/download/arxiv-astro-ph9710220/astro-ph9710220.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> File Archive [PDF] </button> </a> <a target="_blank" rel="external noopener" href="https://arxiv.org/abs/astro-ph/9710220v1" title="arxiv.org access"> <button class="ui compact blue labeled icon button serp-button"> <i class="file alternate outline icon"></i> arxiv.org </button> </a>

Regulation of Plant Pyruvate Dehydrogenase Complex by Phosphorylation

P. M. Rubin, D. D. Randall
<span title="1977-07-01">1977</span> <i title="American Society of Plant Biologists (ASPB)"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/lyouqq67dncvxgcbflq26svwta" style="color: black;">Plant Physiology</a> </i> &nbsp;
Femmer, M. Fenko, and B. Rapp for their technical assistance and to W. L. Zahler for his critical discussion.  ...  Vol. 60, 1977 35 T ---T I RUBIN AND RANDALL Plant Physiol.  ...  Mitochondria were isolated from broccoli and cauliflower (Brassica oleracea) floral buds as described by Rubin and Randall (18) .  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1104/pp.60.1.34">doi:10.1104/pp.60.1.34</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/16660037">pmid:16660037</a> <a target="_blank" rel="external noopener" href="https://pubmed.ncbi.nlm.nih.gov/PMC542541/">pmcid:PMC542541</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/asj2lpzocva4tbppczfjke35xi">fatcat:asj2lpzocva4tbppczfjke35xi</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20190503110507/http://www.plantphysiol.org/content/plantphysiol/60/1/34.full.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/ef/b2/efb28de06707ff9093832aff8677f7da0036746b.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1104/pp.60.1.34"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> Publisher / doi.org </button> </a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC542541" title="pubmed link"> <button class="ui compact blue labeled icon button serp-button"> <i class="file alternate outline icon"></i> pubmed.gov </button> </a>

Nucleotide sequence and structure of the sevenless gene of Drosophila melanogaster

D D Bowtell, M A Simon, G M Rubin
<span title="1988-06-01">1988</span> <i title="Cold Spring Harbor Laboratory"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/g3c3nr2oafg6jb6ivw6sj5giuu" style="color: black;">Genes &amp; Development</a> </i> &nbsp;
D D Bowtell, M A Simon and G M Rubin Drosophila melanogaster. Nucleotide sequence and structure of the sevenless gene of References http://genesdev.cshlp.org/content/2/6/620.full.html#ref-list-1  ...  A Q Q L K L D L G | I ' | % S G R W V P R R L S F D W L H H R L Y F A M E S P E R § 6 5 2 2753 ACCAATCCAGCTTTCAGATTATCAGCACAGATTTGCTGGGTGAATCAGCGCAGAAAGTGGGCGAGTCCTTTGATCTGCCCGTTGAGCAGTTGGAAGTGGATGCCCTGAATGGCTGGATTT  ...  T H S A R N E K P A K D L T E S V L L V G R R A V M W Q S L E P A G E N S M I Y 572 6X7-^ 1-^6X8 2513 ATCAATCTCAGGAGGAATT6GCTGATATCGCCTGGTCAAAGCGGGAGCAACAACTGTGGCTGCTCAACGTCCATGGAGAGTTGCGCAGCTTAAAATTTGAATCCGGCCAGATGGTGAGTC  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1101/gad.2.6.620">doi:10.1101/gad.2.6.620</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/3138161">pmid:3138161</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/wna5pblvzjgn7f2ns2emo4ilce">fatcat:wna5pblvzjgn7f2ns2emo4ilce</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20180722173948/http://genesdev.cshlp.org/content/2/6/620.full.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/b8/4f/b84f7fbd8bf33638e7f2c5fd21f22a64baaed821.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1101/gad.2.6.620"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> Publisher / doi.org </button> </a>

Gravity with Higher Derivatives in D-Dimensions

Sergey G. Rubin, Arkadiy Popov, Polina M. Petriakova
<span title="2020-10-20">2020</span> <i title="MDPI AG"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/vccdvorg3fbgppqlyxxkdsvlfm" style="color: black;">Universe</a> </i> &nbsp;
The aim of this review is to discuss the ways to obtain results based on gravity with higher derivatives in D-dimensional world.  ...  For two-dimensional extra space (n = 2, V 2 = 4π), M Pl = V 2 e 2β m f (φ m )m D = 8π(2a + 1 φ m )m D ∼ 10m D , (106) which means that the D-dim Planck mass m D is in the order of magnitude smaller than  ...  The entropy growth in T × M d 1 × M d 2 manifold leads to the entropy minimization of subspace M d 2 [25] .  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.3390/universe6100187">doi:10.3390/universe6100187</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/gt7wj3scrjaapkdtsfwlbnxs2m">fatcat:gt7wj3scrjaapkdtsfwlbnxs2m</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20201122130551/https://res.mdpi.com/d_attachment/universe/universe-06-00187/article_deploy/universe-06-00187.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/75/fc/75fc08bdcdb41c05c16c17308eb04f7739c89b24.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.3390/universe6100187"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="unlock alternate icon" style="background-color: #fb971f;"></i> mdpi.com </button> </a>

Barton F. Branstetter 4th, Daniel L. Rubin, D. Scott Griffin, David L. Weiss (eds): Practical Imaging Informatics. Foundations and Applications for PACS Professionals

Thomas M. Deserno
<span title="2011-11-04">2011</span> <i title="Springer Nature"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/7mxsagdhtrbahmfd6mjpsonp7a" style="color: black;">Journal of digital imaging</a> </i> &nbsp;
He is focusing on (a) digital radiology and digital mammography, (b) digital fluoroscopy and interventional radiology, (c) computed tomography, (d) magnetic resonance imaging (MRI) and spectroscopy (MRS  ...  Branstetter 4th and his associated editors Rubin, Griffin, and Weiss have accomplished a considerable amount within the pages of this book and have managed to integrate a large number of complex subject  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1007/s10278-011-9427-5">doi:10.1007/s10278-011-9427-5</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/o6rbopl2mndsjbrfiykoe3h6nm">fatcat:o6rbopl2mndsjbrfiykoe3h6nm</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20180718215733/https://link.springer.com/content/pdf/10.1007%2Fs10278-011-9427-5.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/dd/96/dd9684136c03f8b8dce3c6308adbc4e3067b6c58.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1007/s10278-011-9427-5"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> springer.com </button> </a>

The future of DNA sequencing

Eric D. Green, Edward M. Rubin, Maynard V. Olson
<span title="2017-10-11">2017</span> <i title="Springer Nature"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/drfdii35rzaibj3aml5uhvr5xm" style="color: black;">Nature</a> </i> &nbsp;
COMMENT © 2 0 1 7 M a c m i l l a n P u b l i s h e r s L i m i t e d , p a r t o f S p r i n g e r N a t u r e . A l l r i g h t s r e s e r v e d .  ...  The future of DNA sequencing Eric D. Green, Edward M. Rubin and Maynard V.  ...  © 2 0 1 7 M a c m i l l a n P u b l i s h e r s L i m i t e d , p a r t o f S p r i n g e r N a t u r e . A l l r i g h t s r e s e r v e d .  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1038/550179a">doi:10.1038/550179a</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/29022931">pmid:29022931</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/pnqh3ahbyvfehl4hnku3cfl6x4">fatcat:pnqh3ahbyvfehl4hnku3cfl6x4</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20180724114806/http://www.nature.com/polopoly_fs/1.22787!/menu/main/topColumns/topLeftColumn/pdf/550179a.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/33/10/3310108ec7bf80da7488cb94ac2d5ae3dc2783ad.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1038/550179a"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> nature.com </button> </a>

p34Cdc28-mediated control of Cln3 cyclin degradation

J Yaglom, M H Linskens, S Sadis, D M Rubin, B Futcher, D Finley
<span title="">1995</span> <i title="American Society for Microbiology"> <a target="_blank" rel="noopener" href="https://fatcat.wiki/container/ki5pr2lmenbmbijbb4tkftguwe" style="color: black;">Molecular and Cellular Biology</a> </i> &nbsp;
CuSO 4 was then added to 100 M, and incubation was resumed for 3 h.  ...  P, D, S, and T residues are underlined.  ... 
<span class="external-identifiers"> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1128/mcb.15.2.731">doi:10.1128/mcb.15.2.731</a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pubmed/7823941">pmid:7823941</a> <a target="_blank" rel="external noopener" href="https://pubmed.ncbi.nlm.nih.gov/PMC231941/">pmcid:PMC231941</a> <a target="_blank" rel="external noopener" href="https://fatcat.wiki/release/eu6lf4ayzne77dypx2nyjapyoq">fatcat:eu6lf4ayzne77dypx2nyjapyoq</a> </span>
<a target="_blank" rel="noopener" href="https://web.archive.org/web/20180719161336/http://mcb.asm.org/content/15/2/731.full.pdf" title="fulltext PDF download" data-goatcounter-click="serp-fulltext" data-goatcounter-title="serp-fulltext"> <button class="ui simple right pointing dropdown compact black labeled icon button serp-button"> <i class="icon ia-icon"></i> Web Archive [PDF] <div class="menu fulltext-thumbnail"> <img src="https://blobs.fatcat.wiki/thumbnail/pdf/06/04/060400bab523e9da9166414b1b903ebe85649e9c.180px.jpg" alt="fulltext thumbnail" loading="lazy"> </div> </button> </a> <a target="_blank" rel="external noopener noreferrer" href="https://doi.org/10.1128/mcb.15.2.731"> <button class="ui left aligned compact blue labeled icon button serp-button"> <i class="external alternate icon"></i> asm.org </button> </a> <a target="_blank" rel="external noopener" href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC231941" title="pubmed link"> <button class="ui compact blue labeled icon button serp-button"> <i class="file alternate outline icon"></i> pubmed.gov </button> </a>
&laquo; Previous Showing results 1 &mdash; 15 out of 144,327 results