A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2016; you can also visit the original URL.
The file type is application/pdf.
Filters
Positive Behavioral Support: Strategies for Teachers
1998
Intervention in School and Clinic
Preserved Fulltext
Positive behavioral support (PBS) is a comprehensive, research-based proactive approach to behavioral support that endeavors to generate comprehensive change for students with challenging behavior. It involves identifying the purpose of challenging behavior, teaching appropriate alternative responses that serve the same purpose as the challenging behavior, consistently rewarding positive behaviors and minimizing the rewards for challenging behavior, and minimizing the physiological,
doi:10.1177/105345129803400103
fatcat:vqthbc4j7baurhmyuf6ik2s5ei
more »
... l, and curricular elements that trigger challenging behavior. Proven PBS strategies include altering the classroom environment, increasing predictability and scheduling, increasing choice making, adapting the curriculum, appreciating positive behaviors, and teaching replacement skills. Relevant sources for those interested in implementing PBS are presented. Positive behavioral support (PBS) is a broad term that describes a comprehensive, researchbased, proactive approach to behavioral support aimed at producing comprehensive change for students with challenging behavior. This article describes what PBS is, the value of exploring why a student exhibits challenging behavior, and certain key PBS strategies teachers can implement in their classrooms. Finally, the article offers relevant resources for those interested in implementing PBS.
MouseFinder: Candidate disease genes from mouse phenotype data
2012
Human Mutation
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
Mouse phenotype data represents a valuable resource for the identification of disease-associated genes, especially where the molecular basis is unknown and there is no clue to the candidate gene's function, pathway involvement or expression pattern. However, until recently these data have not been systematically used due to difficulties in mapping between clinical features observed in humans and mouse phenotype annotations. Here, we describe a semantic approach to solve this problem and
doi:10.1002/humu.22051
pmid:22331800
pmcid:PMC3327758
fatcat:ntsdkmtgbffxhb36zx5tn3pmt4
more »
... ate highly significant recall of known disease-gene associations and orthology relationships. A web application (MouseFinder; www.mousemodels.org) has been developed to allow users to search the results of our whole-phenome comparison of human and mouse. We demonstrate its use in identifying ARTN as a strong candidate gene within the 1p34.1-p32 mapped locus for a hereditary form of ptosis.
Isolation and characterization of the TSA/trans-sialidase family gene from the Silvio strain of Trypanosoma cruzi
1993
Molecular and biochemical parasitology (Print)
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2019; you can also visit the original URL.
The file type is application/pdf.
We thank Barbara Granger for assistance in maintenance and growth of parasite cultures. ...
doi:10.1016/0166-6851(93)90184-y
pmid:8114812
fatcat:kc7nysdb7bcwlj7c3alcync6n4
Expression and evolution of members of the Trypanosoma cruzi trypomastigote surface antigen multigene family
1994
Molecular and biochemical parasitology (Print)
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2019; you can also visit the original URL.
The file type is application/pdf.
Granger for technical assistance and J. Lucchesi, A. James and W. Fitch for many helpful discussions. This research was supported by grant AI18873 from the National Institutes of Health.
References ...
~,w~~~f~
TSA-EI
G--
-J~
820
G
830
840
850
860
870
880
890
TSA-E3
TSA-E2
GCATGCCGTTCCCCCCGCGTCACCGAATGGGAGGAGGGAACACTTCTCATGGTTACTTATTGCGAGGATGGCCGC
2170
2180
2190
2200
2210
2220
2230 ...
doi:10.1016/0166-6851(94)90013-2
pmid:8183309
fatcat:7d77smcwcbhhji6c3gdxknd2aq
Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research
2014
F1000Research
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research. F1000Research, 2, [30].
doi:10.12688/f1000research.2-30.v2
pmid:24358873
pmcid:PMC3799545
fatcat:267pqfzlvjfmxlz6xpel6qwtgu
Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research
2013
F1000Research
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2020; you can also visit the original URL.
The file type is application/pdf.
Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research. F1000Research, 2, [30].
doi:10.3410/f1000research.2-30.v1
fatcat:v4uquzeugvfr3b6qen4jpswkyy
Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research
2013
F1000Research
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2018; you can also visit the original URL.
The file type is application/pdf.
F1000Research Sebastian Köhler ( ), Christopher J Mungall ( ) Corresponding authors: sebastian.koehler@charite.de CJMungall@lbl.gov Köhler S, Doelken SC, Ruef BJ How to cite this article: et al. ...
J Biomed Inform. 2011; 44(1): 80-6. PubMed Abstract | Publisher Full Text | Free Full Text 17. ...
doi:10.12688/f1000research.2-30.v1
pmid:24358873
pmcid:PMC3799545
fatcat:wraclszcvrfbddvhdqdflkj7zq
Nucleotide sequence and transcription of a trypomastigote surface antigen gene of Trypanosoma cruzi
1991
Molecular and biochemical parasitology (Print)
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2019; you can also visit the original URL.
The file type is application/pdf.
Acknowledgements We thank Barbara Granger for assistance in maintenance and growth of parasite cultures, Stuart Kahn and Harvey Eisen for thoughtful suggestions and sharing unpublished data, and Jim Massey ...
doi:10.1016/0166-6851(91)90043-6
pmid:1717846
fatcat:ne6ydfd6snaftpbf2rszx2afva
A method of identifying and isolating a unique member of a multigene family: application to a trypanosome surface antigen gene
1991
Nucleic Acids Research
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2018; you can also visit the original URL.
The file type is application/pdf.
A novel 78-kDa fatty acyl-CoA synthetase (ACS1) of Babesia bovis stimulates memory CD4+ T lymphocyte responses in B. bovis-immune cattle
2006
Molecular and biochemical parasitology (Print)
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2017; you can also visit the original URL.
The file type is application/pdf.
A novel 78-kDa fatty acyl-CoA synthetase (ACS1) of Babesia bovis stimulates memory CD4 + T lymphocyte responses in B. bovis-immune cattle ଝ Abstract Antigen-specific CD4 + T lymphocyte responses contribute to protective immunity against Babesia bovis, however the antigens that induce these responses remain largely unknown. A proteomic approach was used to identify novel B. bovis antigens recognized by memory CD4 + T cells from immune cattle. Fractions obtained from merozoites separated by
doi:10.1016/j.molbiopara.2006.01.004
pmid:16469396
fatcat:d5ddnobyvndhzkapnuiz5jpteu
more »
... uous-flow electrophoresis (CFE) that contained proteins ranging from 20 to 83 kDa were previously shown to stimulate memory CD4 + lymphocyte responses in B. bovis-immune cattle. Expression library screening with rabbit antiserum raised against an immunostimulatory CFE fraction identified a clone encoding a predicted 78 kDa protein. BLAST analysis revealed sequence identity of this B. bovis protein with Plasmodium falciparum fatty acyl coenzyme A synthetase (ACS) family members (PfACS1-PfACS11), and the protein was designated B. bovis acyl-CoA synthetase 1 (ACS1). Southern blot analysis indicated that B. bovis ACS1 is encoded by a single gene, although BLAST analysis of the preliminary B. bovis genome sequence identified two additional family members, ACS2 and ACS3. Peripheral blood lymphocytes and CD4 + T cell lines from B. bovis-immune cattle proliferated significantly against recombinant ACS1 protein, consistent with its predicted involvement in protective immunity. However, immune sera from cattle recovered from B. bovis infection did not react with ACS1, indicating that epitopes may be conformationally dependent.
ZFIN, the Zebrafish Model Organism Database: increased support for mutants and transgenics
2012
Nucleic Acids Research
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2019; you can also visit the original URL.
The file type is application/pdf.
ZFIN, the Zebrafish Model Organism Database (http://zfin.org), is the central resource for zebrafish genetic, genomic, phenotypic and developmental data. ZFIN curators manually curate and integrate comprehensive data involving zebrafish genes, mutants, transgenics, phenotypes, genotypes, gene expressions, morpholinos, antibodies, anatomical structures and publications. Integrated views of these data, as well as data gathered through collaborations and data exchanges, are provided through a wide
doi:10.1093/nar/gks938
pmid:23074187
pmcid:PMC3531097
fatcat:uzddasd6qrhjvmphh7z4qtp3ay
more »
... selection of web-based search forms. Among the vertebrate model organisms, zebrafish are uniquely well suited for rapid and targeted generation of mutant lines. The recent rapid production of mutants and transgenic zebrafish is making management of data associated with these resources particularly important to the research community. Here, we describe recent enhancements to ZFIN aimed at improving our support for mutant and transgenic lines, including (i) enhanced mutant/ transgenic search functionality; (ii) more expressive phenotype curation methods; (iii) new downloads files and archival data access; (iv) incorporation of new data loads from laboratories undertaking large-scale generation of mutant or transgenic lines and (v) new GBrowse tracks for transgenic insertions, genes with antibodies and morpholinos.
The Human Phenotype Ontology project: linking molecular biology and disease through phenotype data
2013
Nucleic Acids Research
Preserved Fulltext
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2021; you can also visit the original URL.
The file type is application/pdf.
The Human Phenotype Ontology (HPO) project, available at http://www.human-phenotype-ontology.org, provides a structured, comprehensive and welldefined set of 10,088 classes (terms) describing human phenotypic abnormalities and 13,326 subclass relations between the HPO classes. In addition we have developed logical definitions for 46% of all HPO classes using terms from ontologies for anatomy, cell types, function, embryology, pathology and other domains. This allows interoperability with
doi:10.1093/nar/gkt1026
pmid:24217912
pmcid:PMC3965098
fatcat:p2ubynvoprbopaeyoboloexzcq
more »
... resources, especially those containing phenotype information on model organisms such as mouse and zebrafish. Here we describe the updated HPO database, which provides annotations of 7,278 human hereditary syndromes listed in OMIM, Orphanet and DECIPHER to classes of the HPO. Various meta-attributes such as frequency, references and negations are associated with each annotation. Several large-scale projects worldwide utilize the HPO for describing phenotype information in their datasets. We have therefore generated equivalence mappings to other phenotype vocabularies such as LDDB, Orphanet, MedDRA, UMLS and phenoDB, allowing integration of existing datasets and interoperability with multiple biomedical resources. We have created various ways to access the HPO database content using flat files, a MySQL database, and Web-based tools. All data and documentation on the HPO project can be found online.
Page 35 of Journal of Education for Library and Information Science Vol. 26, Issue Directory Issue
[page]
1985
Journal of Education for Library and Information Science
Preserved Fulltext
The Internet Archive has digitized a microfilm copy of this work. It may be possible to borrow a copy for reading.
(FT) S.CT Molod, Samuel (PT) S.CT
Ruef, Joseph (PT) S.CT
DiMattia, Ernest (SS) S.CT McCrossan, John A. (FT) S.FL Pfister, Fred C. (FT) S.FL Mika, Joseph J. ...
(FT) N.TX Zuck, Gregory J. (FT) N.TX Daniel, Evelyn H. (FT) AC CH Carpenter, Raymond L. (FT) NC CH Moran, Barbara B. (FT) NC CH Neenan, Peter (FT) NC CH Baker, Sharon L. ...
Page 1276 of Psychological Abstracts Vol. 89, Issue 3
[page]
2002
Psychological Abstracts
Preserved Fulltext
The Internet Archive has digitized a microfilm copy of this work. It may be possible to borrow a copy for reading.
., 8076
Rue, Judith, 6555
Rueckert, Linda, 7156
Ruef, Anna M., 8153
Ruef, Michael B., 8984 Rufener, S. ...
Chris, 9307 Rinaldi, Daisy, 7151
Rind, Bruce, 9525
Ring, Haim, 6751
Ringel, Brenda L., 8822 Ripley, Tamzin L., 6946 Risman, Barbara J., 7737 Rissenberg, Marian, 8416 Rissotto, Antonella, 7374, 7400 Ristock ...
Page 22 of The Volta Review Vol. 58, Issue 1
[page]
1956
The Volta Review
Preserved Fulltext
The Internet Archive has digitized a microfilm copy of this work. It may be possible to borrow a copy for reading.
Pickering, Dorothy Pickett, Barbara Policastro, Mrs. Joseph Posco, Andrew J. Powaski.
R Mr. & Mrs. Wm. Reeves, A. Richardson, Marie A. ...
Roth, Frances Ruef, Waldo B. Russell, Margaret Ann Rust. S Louis Salatech, Laura G. Sartori, Marie L. Schwanke, Vernon Scopel, Helen Scriver, John C. Shull, M.D., S. Richard Silverman, Mrs. Philip S. ...
« Previous
Showing results 1 — 15 out of 123 results