Filters








123 Hits in 3.0 sec

Positive Behavioral Support: Strategies for Teachers

Michael B. Ruef, Cindy Higgins, Barbara J. C. Glaeser, Marianne Patnode
1998 Intervention in School and Clinic  
Positive behavioral support (PBS) is a comprehensive, research-based proactive approach to behavioral support that endeavors to generate comprehensive change for students with challenging behavior. It involves identifying the purpose of challenging behavior, teaching appropriate alternative responses that serve the same purpose as the challenging behavior, consistently rewarding positive behaviors and minimizing the rewards for challenging behavior, and minimizing the physiological,
more » ... l, and curricular elements that trigger challenging behavior. Proven PBS strategies include altering the classroom environment, increasing predictability and scheduling, increasing choice making, adapting the curriculum, appreciating positive behaviors, and teaching replacement skills. Relevant sources for those interested in implementing PBS are presented. Positive behavioral support (PBS) is a broad term that describes a comprehensive, researchbased, proactive approach to behavioral support aimed at producing comprehensive change for students with challenging behavior. This article describes what PBS is, the value of exploring why a student exhibits challenging behavior, and certain key PBS strategies teachers can implement in their classrooms. Finally, the article offers relevant resources for those interested in implementing PBS.
doi:10.1177/105345129803400103 fatcat:vqthbc4j7baurhmyuf6ik2s5ei

MouseFinder: Candidate disease genes from mouse phenotype data

Chao-Kung Chen, Christopher J. Mungall, Georgios V. Gkoutos, Sandra C. Doelken, Sebastian Köhler, Barbara J. Ruef, Cynthia Smith, Monte Westerfield, Peter N. Robinson, Suzanna E. Lewis, Paul N. Schofield, Damian Smedley
2012 Human Mutation  
Mouse phenotype data represents a valuable resource for the identification of disease-associated genes, especially where the molecular basis is unknown and there is no clue to the candidate gene's function, pathway involvement or expression pattern. However, until recently these data have not been systematically used due to difficulties in mapping between clinical features observed in humans and mouse phenotype annotations. Here, we describe a semantic approach to solve this problem and
more » ... ate highly significant recall of known disease-gene associations and orthology relationships. A web application (MouseFinder; www.mousemodels.org) has been developed to allow users to search the results of our whole-phenome comparison of human and mouse. We demonstrate its use in identifying ARTN as a strong candidate gene within the 1p34.1-p32 mapped locus for a hereditary form of ptosis.
doi:10.1002/humu.22051 pmid:22331800 pmcid:PMC3327758 fatcat:ntsdkmtgbffxhb36zx5tn3pmt4

Isolation and characterization of the TSA/trans-sialidase family gene from the Silvio strain of Trypanosoma cruzi

Barbara J. Ruef, Jerry E. Manning
1993 Molecular and biochemical parasitology (Print)  
We thank Barbara Granger for assistance in maintenance and growth of parasite cultures.  ... 
doi:10.1016/0166-6851(93)90184-y pmid:8114812 fatcat:kc7nysdb7bcwlj7c3alcync6n4

Expression and evolution of members of the Trypanosoma cruzi trypomastigote surface antigen multigene family

Barbara J. Ruef, Bradley D. Dawson, Devansu Tewari, David L. Fouts, Jerry E. Manning
1994 Molecular and biochemical parasitology (Print)  
Granger for technical assistance and J. Lucchesi, A. James and W. Fitch for many helpful discussions. This research was supported by grant AI18873 from the National Institutes of Health. References  ...  ~,w~~~f~ TSA-EI G-- -J~ 820 G 830 840 850 860 870 880 890 TSA-E3 TSA-E2 GCATGCCGTTCCCCCCGCGTCACCGAATGGGAGGAGGGAACACTTCTCATGGTTACTTATTGCGAGGATGGCCGC 2170 2180 2190 2200 2210 2220 2230  ... 
doi:10.1016/0166-6851(94)90013-2 pmid:8183309 fatcat:7d77smcwcbhhji6c3gdxknd2aq

Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research

Sebastian Köhler, Sandra C Doelken, Barbara J Ruef, Sebastian Bauer, Nicole Washington, Monte Westerfield, George Gkoutos, Paul Schofield, Damian Smedley, Suzanna E Lewis, Peter N Robinson, Christopher J Mungall
2014 F1000Research  
Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research. F1000Research, 2, [30].
doi:10.12688/f1000research.2-30.v2 pmid:24358873 pmcid:PMC3799545 fatcat:267pqfzlvjfmxlz6xpel6qwtgu

Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research

Sebastian Köhler, Sandra C Doelken, Barbara J Ruef, Sebastian Bauer, Nicole Washington, Monte Westerfield, George Gkoutos, Paul Schofield, Damian Smedley, Suzanna E Lewis, Peter N Robinson, Christopher J Mungall
2013 F1000Research  
Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research. F1000Research, 2, [30].
doi:10.3410/f1000research.2-30.v1 fatcat:v4uquzeugvfr3b6qen4jpswkyy

Construction and accessibility of a cross-species phenotype ontology along with gene annotations for biomedical research

Sebastian Köhler, Sandra C Doelken, Barbara J Ruef, Sebastian Bauer, Nicole Washington, Monte Westerfield, George Gkoutos, Paul Schofield, Damian Smedley, Suzanna E Lewis, Peter N Robinson, Christopher J Mungall
2013 F1000Research  
F1000Research Sebastian Köhler ( ), Christopher J Mungall ( ) Corresponding authors: sebastian.koehler@charite.de CJMungall@lbl.gov Köhler S, Doelken SC, Ruef BJ How to cite this article: et al.  ...  J Biomed Inform. 2011; 44(1): 80-6. PubMed Abstract | Publisher Full Text | Free Full Text 17.  ... 
doi:10.12688/f1000research.2-30.v1 pmid:24358873 pmcid:PMC3799545 fatcat:wraclszcvrfbddvhdqdflkj7zq

Nucleotide sequence and transcription of a trypomastigote surface antigen gene of Trypanosoma cruzi

David L. Fouts, Barbara J. Ruef, Peter T. Ridley, Ruth A. Wrightsman, David S. Peterson, Jerry E. Manning
1991 Molecular and biochemical parasitology (Print)  
Acknowledgements We thank Barbara Granger for assistance in maintenance and growth of parasite cultures, Stuart Kahn and Harvey Eisen for thoughtful suggestions and sharing unpublished data, and Jim Massey  ... 
doi:10.1016/0166-6851(91)90043-6 pmid:1717846 fatcat:ne6ydfd6snaftpbf2rszx2afva

A method of identifying and isolating a unique member of a multigene family: application to a trypanosome surface antigen gene

Barbara J. Ruef, Jonathan H. Hecht, Jerry E. Manning
1991 Nucleic Acids Research  
doi:10.1093/nar/19.8.1811 pmid:2030963 pmcid:PMC328109 fatcat:m3cl7cdsandy5o23rzbolhapai

A novel 78-kDa fatty acyl-CoA synthetase (ACS1) of Babesia bovis stimulates memory CD4+ T lymphocyte responses in B. bovis-immune cattle

Junzo Norimine, Barbara J. Ruef, Guy H. Palmer, Donald P. Knowles, David R. Herndon, Allison C. Rice-Ficht, Wendy C. Brown
2006 Molecular and biochemical parasitology (Print)  
A novel 78-kDa fatty acyl-CoA synthetase (ACS1) of Babesia bovis stimulates memory CD4 + T lymphocyte responses in B. bovis-immune cattle ଝ Abstract Antigen-specific CD4 + T lymphocyte responses contribute to protective immunity against Babesia bovis, however the antigens that induce these responses remain largely unknown. A proteomic approach was used to identify novel B. bovis antigens recognized by memory CD4 + T cells from immune cattle. Fractions obtained from merozoites separated by
more » ... uous-flow electrophoresis (CFE) that contained proteins ranging from 20 to 83 kDa were previously shown to stimulate memory CD4 + lymphocyte responses in B. bovis-immune cattle. Expression library screening with rabbit antiserum raised against an immunostimulatory CFE fraction identified a clone encoding a predicted 78 kDa protein. BLAST analysis revealed sequence identity of this B. bovis protein with Plasmodium falciparum fatty acyl coenzyme A synthetase (ACS) family members (PfACS1-PfACS11), and the protein was designated B. bovis acyl-CoA synthetase 1 (ACS1). Southern blot analysis indicated that B. bovis ACS1 is encoded by a single gene, although BLAST analysis of the preliminary B. bovis genome sequence identified two additional family members, ACS2 and ACS3. Peripheral blood lymphocytes and CD4 + T cell lines from B. bovis-immune cattle proliferated significantly against recombinant ACS1 protein, consistent with its predicted involvement in protective immunity. However, immune sera from cattle recovered from B. bovis infection did not react with ACS1, indicating that epitopes may be conformationally dependent.
doi:10.1016/j.molbiopara.2006.01.004 pmid:16469396 fatcat:d5ddnobyvndhzkapnuiz5jpteu

ZFIN, the Zebrafish Model Organism Database: increased support for mutants and transgenics

Douglas G. Howe, Yvonne M. Bradford, Tom Conlin, Anne E. Eagle, David Fashena, Ken Frazer, Jonathan Knight, Prita Mani, Ryan Martin, Sierra A. Taylor Moxon, Holly Paddock, Christian Pich (+9 others)
2012 Nucleic Acids Research  
ZFIN, the Zebrafish Model Organism Database (http://zfin.org), is the central resource for zebrafish genetic, genomic, phenotypic and developmental data. ZFIN curators manually curate and integrate comprehensive data involving zebrafish genes, mutants, transgenics, phenotypes, genotypes, gene expressions, morpholinos, antibodies, anatomical structures and publications. Integrated views of these data, as well as data gathered through collaborations and data exchanges, are provided through a wide
more » ... selection of web-based search forms. Among the vertebrate model organisms, zebrafish are uniquely well suited for rapid and targeted generation of mutant lines. The recent rapid production of mutants and transgenic zebrafish is making management of data associated with these resources particularly important to the research community. Here, we describe recent enhancements to ZFIN aimed at improving our support for mutant and transgenic lines, including (i) enhanced mutant/ transgenic search functionality; (ii) more expressive phenotype curation methods; (iii) new downloads files and archival data access; (iv) incorporation of new data loads from laboratories undertaking large-scale generation of mutant or transgenic lines and (v) new GBrowse tracks for transgenic insertions, genes with antibodies and morpholinos.
doi:10.1093/nar/gks938 pmid:23074187 pmcid:PMC3531097 fatcat:uzddasd6qrhjvmphh7z4qtp3ay

The Human Phenotype Ontology project: linking molecular biology and disease through phenotype data

Sebastian Köhler, Sandra C. Doelken, Christopher J. Mungall, Sebastian Bauer, Helen V. Firth, Isabelle Bailleul-Forestier, Graeme C. M. Black, Danielle L. Brown, Michael Brudno, Jennifer Campbell, David R. FitzPatrick, Janan T. Eppig (+35 others)
2013 Nucleic Acids Research  
The Human Phenotype Ontology (HPO) project, available at http://www.human-phenotype-ontology.org, provides a structured, comprehensive and welldefined set of 10,088 classes (terms) describing human phenotypic abnormalities and 13,326 subclass relations between the HPO classes. In addition we have developed logical definitions for 46% of all HPO classes using terms from ontologies for anatomy, cell types, function, embryology, pathology and other domains. This allows interoperability with
more » ... resources, especially those containing phenotype information on model organisms such as mouse and zebrafish. Here we describe the updated HPO database, which provides annotations of 7,278 human hereditary syndromes listed in OMIM, Orphanet and DECIPHER to classes of the HPO. Various meta-attributes such as frequency, references and negations are associated with each annotation. Several large-scale projects worldwide utilize the HPO for describing phenotype information in their datasets. We have therefore generated equivalence mappings to other phenotype vocabularies such as LDDB, Orphanet, MedDRA, UMLS and phenoDB, allowing integration of existing datasets and interoperability with multiple biomedical resources. We have created various ways to access the HPO database content using flat files, a MySQL database, and Web-based tools. All data and documentation on the HPO project can be found online.
doi:10.1093/nar/gkt1026 pmid:24217912 pmcid:PMC3965098 fatcat:p2ubynvoprbopaeyoboloexzcq

Page 35 of Journal of Education for Library and Information Science Vol. 26, Issue Directory Issue [page]

1985 Journal of Education for Library and Information Science  
(FT) S.CT Molod, Samuel (PT) S.CT Ruef, Joseph (PT) S.CT DiMattia, Ernest (SS) S.CT McCrossan, John A. (FT) S.FL Pfister, Fred C. (FT) S.FL Mika, Joseph J.  ...  (FT) N.TX Zuck, Gregory J. (FT) N.TX Daniel, Evelyn H. (FT) AC CH Carpenter, Raymond L. (FT) NC CH Moran, Barbara B. (FT) NC CH Neenan, Peter (FT) NC CH Baker, Sharon L.  ... 

Page 1276 of Psychological Abstracts Vol. 89, Issue 3 [page]

2002 Psychological Abstracts  
., 8076 Rue, Judith, 6555 Rueckert, Linda, 7156 Ruef, Anna M., 8153 Ruef, Michael B., 8984 Rufener, S.  ...  Chris, 9307 Rinaldi, Daisy, 7151 Rind, Bruce, 9525 Ring, Haim, 6751 Ringel, Brenda L., 8822 Ripley, Tamzin L., 6946 Risman, Barbara J., 7737 Rissenberg, Marian, 8416 Rissotto, Antonella, 7374, 7400 Ristock  ... 

Page 22 of The Volta Review Vol. 58, Issue 1 [page]

1956 The Volta Review  
Pickering, Dorothy Pickett, Barbara Policastro, Mrs. Joseph Posco, Andrew J. Powaski. R Mr. & Mrs. Wm. Reeves, A. Richardson, Marie A.  ...  Roth, Frances Ruef, Waldo B. Russell, Margaret Ann Rust. S Louis Salatech, Laura G. Sartori, Marie L. Schwanke, Vernon Scopel, Helen Scriver, John C. Shull, M.D., S. Richard Silverman, Mrs. Philip S.  ... 
« Previous Showing results 1 — 15 out of 123 results