Filters








76 Hits in 4.1 sec

Molecular characterization of the re-emerging West Nile virus in avian species and equids in Israel, 2018, and pathological description of the disease

Gili Schvartz, Yigal Farnoushi, Asaf Berkowitz, Nir Edery, Shelly Hahn, Amir Steinman, Avishai Lublin, Oran Erster
2020 Parasites & Vectors  
Phylogenetic analysis of a 906-bp genomic segment showed that all samples belonged to Lineage 1 clade 1a, with the following partition: five samples from 2018 and one sample detected in 2016 were of Cluster  ...  Conclusions WNV is constantly circulating in wild and domesticated birds and animals in Israel, necessitating constant surveillance in birds and equines.  ...  Healthy bird in quarantine 1505 Corvus cornix, hooded crow 18 October 2018 Unknown + Tel-Aviv Found dead 1514 Corvus cornix, hooded crow 18 October 2018 + Unknown Tel-Aviv Found sick, died  ... 
doi:10.1186/s13071-020-04399-2 pmid:33092614 fatcat:yowemfdr45bh7cnqbwkwfykd64

IL-17A Inhibitor Switching – Efficacy of Ixekizumab Following Secukinumab Failure. A Single-Center Experience

S Sherman, E Cohen, I Amitay-Laish, E Hodak, L Pavlovsky
2019 Acta Dermato-Venereologica  
Aviv University, Tel Aviv, Israel 1 Table I .  ...  /M 31 24.7 None Yes ETN/2012 12.0 6.7 Ongoing 90 50 17 72.1/F 28.3 Face DYS, HTN, DM Yes ETN/2016 2.0 6.4 PF* 100 100 18 50.2/F 33 PPP DYS, HTN, DM Yes ADA/2016 1.0 4.1  ... 
doi:10.2340/00015555-3200 pmid:31017250 fatcat:skzpgtfsnfcm5ax35rswv3taiu

Estimation of Hourly near Surface Air Temperature Across Israel Using an Ensemble Model

Bin Zhou, Evyatar Erell, Ian Hough, Alexandra Shtein, Allan C. Just, Victor Novack, Jonathan Rosenblatt, Itai Kloog
2020 Remote Sensing  
Demonstrated for Israel for the period 2004–2017, the proposed ensemble model outperformed each of the two base learners.  ...  Figure 18 . 18 The simulated hourly 1 × 1 km 2 Ta at 4-h intervals for three metropolitan areas in Israel (Tel Aviv, Haifa, and Beer Sheva) on 15 January 2016.  ...  Figure 18 . 18 The simulated hourly 1 × 1 km 2 Ta at 4-h intervals for three metropolitan areas in Israel (Tel Aviv, Haifa, and Beer Sheva) on 15 January 2016.  ... 
doi:10.3390/rs12111741 fatcat:epxq27j6ybbgjpvnmzgsb5hxci

Dynamic Proteomic Analysis of Pancreatic Mesenchyme Reveals Novel Factors That Enhance Human Embryonic Stem Cell to Pancreatic Cell Differentiation

Holger A. Russ, Limor Landsman, Christopher L. Moss, Roger Higdon, Renee L. Greer, Kelly Kaihara, Randy Salamon, Eugene Kolker, Matthias Hebrok
2016 Stem Cells International  
Shimon Efrat (Tel Aviv University, Israel) for the kind gift of purified human islet RNA and Dr. Sheng Ding (Gladstone Institute, San Francisco, USA) for human foreskin fibroblasts.  ...  Skyline analysis software was used to set up inclusion lists for peptide sequences extract peak intensity values and provide spectral libraries [13] .  ...  Primer sequences are as follows: LGALS1 ATCGTGTGCAACAGCAAGG and CCTGGTCGAAGG-TGATGC; LAMA2 AAAGATCCTTCCAAGAACAAAATC and CGGTCAGCTTCCTGTTCTAAA; NPTN TCTCGC-TGTTGCTGGTCTC and CCTCTTCACTGGTGACAA-TCC; NGN3  ... 
doi:10.1155/2016/6183562 pmid:26681951 pmcid:PMC4670689 fatcat:t6isycee3jdmrezpmzl453adxa

Molecular basis of the STIL coiled coil oligomerization explains its requirement for de-novo formation of centrosomes in mammalian cells

Ahuvit David, Hadar Amartely, Noa Rabinowicz, Mai Shamir, Assaf Friedler, Shai Izraeli
2016 Scientific Reports  
Mouse oocytes and early embryos lack centrioles until the blastocyst stage 13-15 . Thereafter, centrioles are generated de novo and are essential for further mammalian development 15, 16 .  ...  These studies were performed as partial requirements of AD and HA for a PhD degree of Tel Aviv and Hebrew universities, respectively.  ...  AD is supported by an Eshkol grant from the Israel Science Ministry. SI is supported by grants from the Israel Science Foundation and Israel Science Ministry.  ... 
doi:10.1038/srep24296 pmid:27075531 pmcid:PMC4830966 fatcat:f2lz4bsmkfe5jikh46dtgtvjpm

On-demand erythrocyte disposal and iron recycling requires transient macrophages in the liver

Igor Theurl, Ingo Hilgendorf, Manfred Nairz, Piotr Tymoszuk, David Haschka, Malte Asshoff, Shun He, Louisa M S Gerhardt, Tobias A W Holderried, Markus Seifert, Sieghart Sopper, Ashley M Fenn (+22 others)
2016 Nature Medicine  
He, et al. 2016. "On-demand erythrocyte disposal and iron recycling requires transient macrophages in the liver." Nature medicine 22 (8): 945-951.  ...  Aviv, Israel). eLPI > 0.3 units indicated the potential for iron-mediated production of reactive oxygen species in the sample.  ...  TAC AGC CGG AAG AT-3′, rv 5′-TGC TGC TTC TCC TAC AGC CGG AAG AT-3′ Cxcl12: fw 5′-TGC TGC TTC TCC TAC AGC CGG AAG AT-3′, rv 5′-TGC TGC TTC TCC TAC AGC CGG AAG AT-3′ Ccl21: fw 5′-TGC TGC TTC TCC TAC AGC  ... 
doi:10.1038/nm.4146 pmid:27428900 pmcid:PMC4957133 fatcat:cn54v6uwbrev7ch6xfmxbwcxlu

Differential effects of HTLV-1 Tax oncoprotein on the different estrogen-induced-ER α-mediated transcriptional activities

Ammar Abou-Kandil, Nora Eisa, Azhar Jabareen, Mahmoud Huleihel
2016 Cell Cycle  
transfection The reporter firefly luciferase (Luc) driven by the BRCA1 promoter (BRCA1-Luc) and Luc reporter driven by estrogen response elements (EREs-Luc) were provided by Haim Werner (Clinical Biochemistry, Tel-Aviv  ...  University, Israel).  ... 
doi:10.1080/15384101.2016.1208871 pmid:27420286 pmcid:PMC5053584 fatcat:sdxajilc65hzdgwhscfp6d4nry

Mimp/Mtch2, an Obesity Susceptibility Gene, Induces Alteration of Fatty Acid Metabolism in Transgenic Mice

Yamit Bar-Lev, Sharon Moshitch-Moshkovitz, Galia Tsarfaty, Dafna Kaufman, Judith Horev, James H. Resau, Ilan Tsarfaty, G. William Wong
2016 PLoS ONE  
Animal care and experimental procedures were approved by the Van Andel Research Institute and Tel Aviv University Institutional Animal Care and Use Committees, and were conducted in accordance with National  ...  Both purchased from Harlan Lab (Jerusalem, Israel).  ... 
doi:10.1371/journal.pone.0157850 pmid:27359329 pmcid:PMC4928869 fatcat:uby5mui2pjgm5ck5dg66len3oi

Penehyclidine ameliorates acute lung injury by inhibiting Toll-like receptor 2/4 expression and nuclear factor-κB activation

NA WANG, YUE SU, XIANG-MING CHE, HUI ZHENG, ZHI-GUO SHI
2016 Experimental and Therapeutic Medicine  
Band Leader 3.0 software (Magnitec, Ltd., Tel Aviv, Israel) was used for semi-quantitative analysis of protein expression.  ...  Anticholinergic drugs are an effective and widely accepted treatment for ALI (13, 14) .  ... 
doi:10.3892/etm.2016.3154 pmid:27168812 pmcid:PMC4840699 fatcat:ntdt7b3rmfdbbd3safwuvb237u

Deletion of Irf3 and Irf7 Genes in Mice Results in Altered Interferon Pathway Activation and Granulocyte-Dominated Inflammatory Responses to Influenza A Infection

Bastian Hatesuer, Hang Thi Thu Hoang, Peggy Riese, Stephanie Trittel, Ingo Gerhauser, Husni Elbahesh, Robert Geffers, Esther Wilk, Klaus Schughart
2016 Journal of Innate Immunity  
** ** Acknowledgements We wish to thank Karin Lammert for excellent technical assistance, and Irit Gat-Viks and Yael Steuerman (Cell Research and Immunology Department, Tel Aviv University, Tel Aviv,  ...  Israel) for help with digital cell quantification.  ...  DCQ analysis was then performed at the public server provided by the University of Tel Aviv (http://dcq.tau.ac.il/) using the immune cell database at http://dcq.tau.ac.il/.  ... 
doi:10.1159/000450705 pmid:27811478 fatcat:ephibb7k4revlbicc7f6qpjgbm

De-coupling or remaining closely coupled to 'home': educational strategies around identity-making and advantage of Israeli global middle-class families in London

Miri Yemini, Claire Maxwell
2018 British Journal of Sociology of Education  
Instead of "living in a bubble" (Efrat) and sending their children to better-off, homogeneous schools in Tel Aviv or its affluent suburbs, these parents have chosen the path of emigration, which is both  ...  , 2016) .  ... 
doi:10.1080/01425692.2018.1454299 fatcat:bdkixv5ilnhwdiv3zhfjeuuu5q

Heat mitigation by greening the cities, a review study

Armaghan Ahmadi Venhari, Martin Tenpierik, Alireza Mahdizadeh Hakak
2017 Environment Earth and Ecology  
-11 - Ref City Type Size (ha) Studied index Results (Shashua- Bar and Hoffman 2000) Tel Aviv, Israel 11 Streets TCC, Tr, CL The average cooling effect equaled to 3K.  ...  -10 - Ref City Type Size (ha) Studied index Results (Potchter et al. 2006) Tel Aviv, Israel 3parks 2.5- 3.5 TCC Grass and different amounts of trees effect on air temperature  ... 
doi:10.24051/eee/67281 fatcat:vavw5gljtbhrvkaikuf5pyq3tu

Symposia

2016 The FEBS Journal  
Slavin Biotherapy International, Tel Aviv, Israel Stem cells are undifferentiated normal or malignant cells that can differentiate and produce either more stem cells or differentiate into specialized cells  ...  The FEBS Journal ª 2016 FEBS The FEBS Journal 283 (Suppl. 1) (2016) 55-56 DOI: 10.1111/febs.13805 © 2016 The Authors The FEBS Journal © 2016 FEBS © 2016 The Authors The FEBS Journal © 2016 FEBS  ... 
doi:10.1111/febs.13805 fatcat:5bh6wnb75nbijopqvhnzhv3bmi

Pomalidomide mitigates neuronal loss, neuroinflammation, and behavioral impairments induced by traumatic brain injury in rat

Jing-Ya Wang, Ya-Ni Huang, Chong-Chi Chiu, David Tweedie, Weiming Luo, Chaim G. Pick, Szu-Yi Chou, Yu Luo, Barry J. Hoffer, Nigel H. Greig, Jia-Yi Wang
2016 Journal of Neuroinflammation  
Tel-Aviv, Israel; (iii) the National Institute of Neurological Disorders and Stroke, NIH (grant RO1NS094152); and (iv) the Intramural Research Program of the National Institute on Aging, NIH (AG 000311  ...  Funding This study was supported in part by (i) a grant from the Ministry of Science and Technology, Taiwan (MOST104-2923-B-038-001-MY3); (ii) the Ari and Regine Aprijaskis Fund at Tel-Aviv University,  ...  GAC TTG TGA AG (reverse); and β-actin, GAC CCA GAT CAT GTT TGA GAC CTT C (forward) and GAG TCC ATC ACA ATG CCW GTG G (reverse).  ... 
doi:10.1186/s12974-016-0631-6 pmid:27353053 pmcid:PMC4924242 fatcat:v7k65k2x3bdwvnzkq3mxc42izi

Concentrated Differential Privacy: Simplifications, Extensions, and Lower Bounds [article]

Mark Bun, Thomas Steinke
2016 arXiv   pre-print
In Theory of Cryptography -13th Interna- tional Conference, TCC 2016-A, Tel Aviv, Israel, January 10-13, 2016, Proceed- ings, Part I, pages 157-175, 2016. [Rén61] Alfréd Rényi.  ...  Although Dwork and Rothblum's work only appeared publicly in March 2016, they shared a preliminary draft of their paper with us before we commenced this work.  ... 
arXiv:1605.02065v1 fatcat:i3t75dfcqfep5ojspimke7xg2e
« Previous Showing results 1 — 15 out of 76 results